ID: 1172411599

View in Genome Browser
Species Human (GRCh38)
Location 20:34727909-34727931
Sequence AGATGGGGGTTTCACCACAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4443
Summary {0: 2, 1: 35, 2: 215, 3: 1458, 4: 2733}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172411592_1172411599 9 Left 1172411592 20:34727877-34727899 CCACGCCCTGCTAATTTTTGTCT 0: 4
1: 701
2: 29415
3: 115655
4: 158078
Right 1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733
1172411591_1172411599 19 Left 1172411591 20:34727867-34727889 CCATGTGACACCACGCCCTGCTA 0: 1
1: 1
2: 68
3: 316
4: 858
Right 1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733
1172411594_1172411599 3 Left 1172411594 20:34727883-34727905 CCTGCTAATTTTTGTCTTTTTAG 0: 296
1: 88338
2: 74359
3: 46507
4: 42146
Right 1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733
1172411593_1172411599 4 Left 1172411593 20:34727882-34727904 CCCTGCTAATTTTTGTCTTTTTA 0: 8
1: 2802
2: 141649
3: 127502
4: 88729
Right 1172411599 20:34727909-34727931 AGATGGGGGTTTCACCACACTGG 0: 2
1: 35
2: 215
3: 1458
4: 2733

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172411599 Original CRISPR AGATGGGGGTTTCACCACAC TGG Intronic
Too many off-targets to display for this crispr