ID: 1172414371

View in Genome Browser
Species Human (GRCh38)
Location 20:34752217-34752239
Sequence CTGCCTTCATAGTTGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172414371_1172414379 27 Left 1172414371 20:34752217-34752239 CCATGCTCCAACTATGAAGGCAG 0: 1
1: 0
2: 0
3: 8
4: 133
Right 1172414379 20:34752267-34752289 CAGACTTCTCCTGAACTCTAAGG 0: 1
1: 0
2: 0
3: 31
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172414371 Original CRISPR CTGCCTTCATAGTTGGAGCA TGG (reversed) Intronic
900939447 1:5788716-5788738 CTGTCTTCAGGTTTGGAGCATGG - Intergenic
903290231 1:22307688-22307710 CTGGCTTCATAGTATGAGTAGGG - Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
909173965 1:72331424-72331446 CTGGCTTCATATTTGTAACATGG - Intergenic
909289107 1:73859465-73859487 TTGCTTTCATGGTTGTAGCAAGG + Intergenic
911170467 1:94766000-94766022 ATCCCTTCATAGTTAAAGCATGG + Intergenic
918149722 1:181787837-181787859 CTGTCATGATGGTTGGAGCATGG + Intronic
918410772 1:184255821-184255843 GTGTCTTCCTAGTTGGAGGAAGG - Intergenic
920235404 1:204500057-204500079 CTGGCTTGAAAGTTGAAGCATGG + Intergenic
1063153174 10:3355136-3355158 CTGCCTTCAGAGATGGAGTCAGG + Intergenic
1063334430 10:5198327-5198349 CTGTTTTCAAAGTTGGAGCCTGG + Intronic
1063481673 10:6381839-6381861 CTGCCTTCATTGTGGAAACAGGG + Intergenic
1063696772 10:8343419-8343441 GATCCTTCAGAGTTGGAGCAAGG + Intergenic
1069982082 10:72259933-72259955 TTTCCTGCATAGATGGAGCAAGG - Intergenic
1072280575 10:93862029-93862051 CAGCCTTCCGAGTTGGTGCAGGG - Intergenic
1074736085 10:116434780-116434802 GTGACTTCATAGTTGGATCATGG - Intronic
1078114991 11:8438690-8438712 CTGCCTTCTTAGTTTGAACTTGG - Intronic
1078899252 11:15626227-15626249 CTGGCTTCAAAGTTGGAGGAAGG - Intergenic
1080843978 11:36010147-36010169 CTGCCTGCACCATTGGAGCAAGG - Intronic
1080859107 11:36137807-36137829 CTGCCTTCATCTCTGCAGCAGGG - Intronic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1084187853 11:67484430-67484452 CTGACTTCAGAGATGCAGCATGG + Intronic
1085278096 11:75312778-75312800 CTGGCTTCAAAGCTGGAGGATGG + Intronic
1087906532 11:103704049-103704071 CTTCCTTCATAGGTGTAGGATGG - Intergenic
1091636884 12:2203757-2203779 CTGCCTTCATACTTGGTCCTGGG + Intronic
1093661628 12:21763997-21764019 CTTCCTTCATAGTCCAAGCAAGG - Intergenic
1093669574 12:21857713-21857735 CTGGCTTCAAAGGTGGAGGAAGG + Intronic
1098364772 12:69690852-69690874 CTACTTTCATATTTGGAGGAAGG + Intronic
1099051868 12:77790579-77790601 CTGGCTTCATGGTTTGATCAGGG + Intergenic
1100280720 12:93115791-93115813 CAGCCTTCAGAGATGGTGCAGGG - Intergenic
1101389673 12:104289022-104289044 CTACCTTCAAGGTTGGACCATGG - Exonic
1105628202 13:22134674-22134696 CTGCCTTCCTGGTTAGAGCCGGG + Intergenic
1105890333 13:24678014-24678036 CTGTCCCAATAGTTGGAGCAGGG + Intergenic
1110712973 13:78670384-78670406 CTGCCTTCACTGTAGGAGCCAGG - Intergenic
1110766007 13:79280010-79280032 CGGCCTACATGGTTGGAGCAGGG - Intergenic
1112839409 13:103558025-103558047 CTGTCACCATAGTGGGAGCATGG + Intergenic
1114399416 14:22395786-22395808 CTGTCTTCAGATTTGGAACAAGG + Intergenic
1114789850 14:25645340-25645362 CTGCCTTCTTTACTGGAGCAAGG + Intergenic
1117319705 14:54609268-54609290 CTGACTTCAAAGATGGAGAAAGG + Intronic
1119738578 14:76999508-76999530 CTGGCTGCATAGTTGGGGAATGG + Intergenic
1122355099 14:101118197-101118219 CTGCCTTCATGTTTGGCACAGGG + Intergenic
1123690232 15:22832648-22832670 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
1124007381 15:25805355-25805377 CTGCCTTCATTGTTGAAAAAAGG + Intronic
1131532690 15:93207129-93207151 CTGCTTTCAGAGTTGGAGAGGGG + Intergenic
1132028610 15:98422478-98422500 CTGCCATTGTAGGTGGAGCAGGG - Intergenic
1133603830 16:7366537-7366559 CAGCCTCCATGGTTGGACCAGGG - Intronic
1141235656 16:82213565-82213587 CTGGCTTCAAAGATGGAGGAGGG + Intergenic
1141574021 16:84952715-84952737 CTGACTTCAGAGGTTGAGCAAGG + Intergenic
1143873181 17:9972224-9972246 CTGCCTTCATAGCGGGTGGATGG - Intronic
1149596211 17:57866320-57866342 CTTCCCTCATAGTTGCGGCAGGG - Intronic
1153521165 18:5955394-5955416 CGCCCTTCAGAGTGGGAGCAGGG + Exonic
1153668094 18:7384268-7384290 CTGCCCTCATAGTTGCACGATGG - Intergenic
1153683306 18:7521677-7521699 CTGCCTCAAGAGGTGGAGCAAGG - Intergenic
1155818393 18:30345100-30345122 CTGCATTCAGAGTTAGAGTAAGG - Intergenic
1156355138 18:36334132-36334154 CTACCTACAGAGTTGGGGCAGGG - Intronic
1157172714 18:45422700-45422722 CTGGCTCCATTGATGGAGCAGGG - Intronic
1157449550 18:47774903-47774925 GTGCCTTCATATTTGGAGACCGG - Intergenic
1157741466 18:50096992-50097014 TTCCCTTCATAGGTGGAGCCAGG - Intronic
1157822272 18:50781338-50781360 GTGCCTTCATAGTTGCAAGATGG + Intergenic
1159732076 18:72040566-72040588 CTGCCTTCTTTTTGGGAGCAGGG - Intergenic
1161845830 19:6711458-6711480 CTGCCTTTAAAGGTGGAGGAAGG + Intronic
1161961300 19:7524885-7524907 CTGCCTTCCTGGTTGGAGAAAGG + Intronic
1163206323 19:15805870-15805892 ATGTCTTCATGGTTGGATCAAGG - Intergenic
1163764457 19:19154978-19155000 CTGCCTCCAGAGTTGGTGTAGGG - Intronic
1165279247 19:34782650-34782672 CTGTCCTCACAGCTGGAGCATGG - Intergenic
1168440827 19:56365669-56365691 CTGCCTCCAAAGTTGGAGACAGG + Intronic
928340613 2:30440077-30440099 CTGACTTCAAAGGTGGAGGAAGG + Intergenic
932144574 2:69306650-69306672 CTGCCTCCGTAGCTGGAGCCAGG - Intergenic
937141426 2:119605171-119605193 CTGCCTTCAGTTTTGGACCAGGG + Exonic
937577288 2:123438911-123438933 CTGCCCTTATATTTGGAGCCTGG - Intergenic
938207144 2:129433700-129433722 CTGCCTCCATAATTGCAGGATGG + Intergenic
938982856 2:136543017-136543039 CTGCCTTCTTAGTTACAGCATGG - Intergenic
941656430 2:168149451-168149473 TTGGTTTCATAGTTGGTGCAGGG - Intronic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
943759458 2:191592521-191592543 CTGGCTTTAAAGATGGAGCAAGG - Intergenic
944676904 2:202041158-202041180 CTGTCAACATAGTTGGAGTAAGG + Intergenic
945849624 2:214989775-214989797 CTTGCTTCACAGTTGTAGCATGG - Intronic
1169713511 20:8590671-8590693 CTGCCTTTGAAGTTGGAGGAAGG - Intronic
1171278001 20:23875012-23875034 CTGGCTTCCTAGGTGCAGCACGG + Intergenic
1172233077 20:33350246-33350268 CGGCCTTCATAGGTGGAAAAGGG + Intergenic
1172414371 20:34752217-34752239 CTGCCTTCATAGTTGGAGCATGG - Intronic
1173801413 20:45896860-45896882 CTGCCTTCTGGGTTGGAGCTTGG + Intronic
1173941510 20:46914926-46914948 CTGCCTTCAAAGCTGGAGTATGG + Intronic
1174264466 20:49321139-49321161 CTGCCTCCTTATCTGGAGCAGGG + Intergenic
1181933582 22:26423345-26423367 CTGCCCTCATATTTGCAGCTTGG - Intergenic
1183246174 22:36695268-36695290 CTGCCTTTATAGTTGTTGTAAGG - Intronic
954532659 3:51334171-51334193 CTGCCTTCTCAGTTGTATCATGG + Intronic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
955650830 3:61192097-61192119 CTGCCTTCATAGTTCTAAGATGG - Intronic
958616187 3:96495692-96495714 CTGCCTCCATAGATTGAGTATGG - Intergenic
959900373 3:111654333-111654355 ATGCCTTCCTGGCTGGAGCATGG - Intronic
960249841 3:115439637-115439659 CAGCCTACATAGTGGGAGGAGGG + Intergenic
964529769 3:157654912-157654934 CTGCTTTCAGTGTTGGGGCATGG - Intronic
966441263 3:179947396-179947418 CTGCCTCCATAATTGGTGTAAGG - Intronic
966482058 3:180421408-180421430 CTGGCTTCAAAGATGGAGTAAGG + Intergenic
968028949 3:195466423-195466445 CTGGCTTCGAAGATGGAGCAAGG - Intergenic
970564773 4:17321120-17321142 CTGCCTTCATTCTTGGGGGAAGG + Intergenic
970573029 4:17401241-17401263 CTGGCTTCAAAGATGGAGGAAGG - Intergenic
973606675 4:52593759-52593781 CTGCCTTCTTATTTGGGGAATGG + Exonic
975514949 4:75236727-75236749 CTGCTTCCAGAGCTGGAGCAAGG + Intergenic
977905746 4:102475852-102475874 TTGTCTTCTTTGTTGGAGCAGGG - Intergenic
979421089 4:120506198-120506220 CTGTCTTCTTTGTTGGAGGAGGG - Intergenic
988600147 5:32632172-32632194 CTGCCTCCACAGATGGAGCAAGG - Intergenic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
994798184 5:104333505-104333527 CTGAGTTCATAGTGGGAACAGGG + Intergenic
995664307 5:114523965-114523987 CTGACTTTTTAGATGGAGCATGG - Intergenic
996058069 5:119001982-119002004 CTGGCTTCACAGATGGAGGATGG - Intergenic
996693740 5:126369566-126369588 CTAGCTTCATTGTTGAAGCAAGG + Intronic
1000600536 5:163269416-163269438 TTGCCCTCATACCTGGAGCATGG + Intergenic
1001234882 5:170021261-170021283 CTGCCTTTTAAGTGGGAGCAAGG + Intronic
1001280215 5:170381408-170381430 CTACCTTCAGAGTTGGAGGGTGG + Intronic
1003806474 6:9730643-9730665 CAGCCTCTATAGTTGGAGGAGGG - Intronic
1004845352 6:19635800-19635822 ATGGCTTCATAGTTAGAGCTGGG - Intergenic
1013796915 6:113898550-113898572 CTCTCTTCAGAGTTGGAGGATGG + Intergenic
1014512571 6:122342212-122342234 CTGGCTTCACAGATGGAGAATGG + Intergenic
1015241733 6:131031769-131031791 CCGCCTTCAGAATTGGAGAAAGG - Intronic
1016728821 6:147406491-147406513 CTTTCTTCATAGTGGGAGCCAGG + Intergenic
1018357996 6:163037872-163037894 TTGTCTTCCTAGTTGGAGTAGGG - Intronic
1019462080 7:1165409-1165431 CTGACTGCAGGGTTGGAGCAGGG - Intergenic
1022010016 7:26300632-26300654 CTGCCTTCAGAGATGGAGGCTGG - Intronic
1022501170 7:30883220-30883242 CTGCCTTCATGGTTGGGGGTGGG + Intronic
1023833116 7:44051755-44051777 CTCCCTTCATGGTGGGACCAGGG + Intronic
1026827170 7:73591668-73591690 CTACCTTCAGAGTTGGAAGAAGG - Intergenic
1027354055 7:77339445-77339467 CTGCCTTCCTTGATGGATCATGG + Intronic
1035015657 7:155763791-155763813 CTGCCTTCTTGGTTTCAGCAGGG + Exonic
1039346215 8:36708438-36708460 CTGCCTTCATAATGCAAGCAAGG - Intergenic
1041193228 8:55374451-55374473 CTGAGTTGATAGTTGAAGCAGGG + Intronic
1041589255 8:59557874-59557896 CTGCATTCAAAGTCGGAGCAGGG - Intergenic
1042489841 8:69384677-69384699 CTGCCTTCATAGAATGAGCTAGG - Intergenic
1044612945 8:94112652-94112674 CTGTCTTCATTTTTGGATCATGG - Intergenic
1048974739 8:139664840-139664862 CTGGCTTCATTCCTGGAGCACGG + Intronic
1050108329 9:2188941-2188963 CTGGCTTTAAAGTTGGAACAAGG - Intronic
1051463340 9:17348836-17348858 CTGCTTTCATTGACGGAGCATGG + Intronic
1052826608 9:33180773-33180795 CTGCCTCCATGGTGGGAGCTAGG + Intergenic
1058621160 9:106884559-106884581 CTGCCTCCATGGTGGGAGGAAGG - Intronic
1058929740 9:109707373-109707395 CTGACTTCAAAGCTGGGGCAGGG - Intronic
1060907465 9:127319878-127319900 ATACCCTCATAGCTGGAGCAAGG + Intronic
1188644892 X:32553775-32553797 CTGTCTTCAGTGTTGGAGGAAGG + Intronic
1195423636 X:104703221-104703243 CTGCCTTCATGTTTGAAGGACGG - Intronic
1196980256 X:121205032-121205054 CTTTCTTCATCGTTGGAGCCAGG - Intergenic
1199943271 X:152645322-152645344 CTGATCTCATAGTTAGAGCAAGG - Intronic
1201482211 Y:14451936-14451958 CTTCCTTCATAGCCAGAGCAAGG + Intergenic