ID: 1172419914

View in Genome Browser
Species Human (GRCh38)
Location 20:34807489-34807511
Sequence ATTCAGCAGGATTTCCATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172419914_1172419918 16 Left 1172419914 20:34807489-34807511 CCTACATGGAAATCCTGCTGAAT 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1172419918 20:34807528-34807550 TCCTTTTTTATTTTTTGAGATGG 0: 7
1: 465
2: 10528
3: 109079
4: 88382

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172419914 Original CRISPR ATTCAGCAGGATTTCCATGT AGG (reversed) Intronic
903363546 1:22792319-22792341 AAGCAGCAGAATTTCTATGTGGG - Intronic
903551510 1:24160179-24160201 ATTCTTCAGGCTTTCCATCTTGG + Intronic
904765472 1:32843170-32843192 TTTCATCAGGTTTTCCCTGTAGG + Intronic
905336457 1:37248000-37248022 ATTTGGCAGCGTTTCCATGTGGG + Intergenic
905542936 1:38774489-38774511 CTTCAGCAGGATTTGCAAGTTGG + Intergenic
908266771 1:62386986-62387008 TTTCATCAGAATTTCCATGGAGG - Intergenic
908810210 1:67974504-67974526 AATCAGCAGCTTTTCCATGCAGG - Intergenic
909773314 1:79453549-79453571 ATTCAGCATGATTTATGTGTGGG + Intergenic
910117251 1:83745546-83745568 ATTCAGCAGGACTAACATGATGG + Intergenic
910539629 1:88341468-88341490 ATTCAGGATGATTTGTATGTGGG - Intergenic
912381955 1:109252475-109252497 GTTCACCAGGATCTCCAGGTAGG - Exonic
913505608 1:119513921-119513943 ATTCTGGATGATTTCCTTGTAGG - Exonic
918577811 1:186084942-186084964 CTGCACCAGGATTTCAATGTAGG + Intronic
920317098 1:205084355-205084377 ATTCAGCTGGAATACCTTGTGGG - Exonic
1062951861 10:1509570-1509592 ATTCTGCAGGATTTGCAGATAGG + Intronic
1063356920 10:5409849-5409871 ATACTGCAGGATGTCAATGTGGG - Intergenic
1066326859 10:34368968-34368990 ATACAGTATGAGTTCCATGTTGG - Intronic
1067384818 10:45809250-45809272 ATTCTGCAGCATTCCCAGGTGGG + Intergenic
1072569932 10:96649719-96649741 ATTCAGCAGGGTTCCTATTTAGG + Intronic
1072740648 10:97907103-97907125 ATTCAGCAGAATTTACCGGTGGG + Intronic
1073601298 10:104848496-104848518 ATTCAGCAGGAATTCCACCAAGG - Intronic
1073729727 10:106273532-106273554 CTTCACCAGGATTTCCACTTTGG + Intergenic
1076411707 10:130256064-130256086 CTTCAGGTGGATTTCCATGCTGG - Intergenic
1077860069 11:6170099-6170121 AGACAGCAGGATGTCCATGACGG + Exonic
1082110842 11:48272058-48272080 GTGCAGCAGGACTTCCATGTGGG - Intergenic
1083880281 11:65545029-65545051 CATCACTAGGATTTCCATGTAGG + Intronic
1085928041 11:81045624-81045646 ATTCTGGAGGATTTCCCTTTGGG + Intergenic
1087216348 11:95499318-95499340 CTTCAGCAGGTTTCCCATATTGG + Intergenic
1090674165 11:128973571-128973593 TTTCAACAGCATTTGCATGTGGG - Intronic
1094148818 12:27259314-27259336 ATTCAGCAGAATTCCCATGCAGG + Intronic
1095411131 12:41924471-41924493 TTTCATCAGAATTTTCATGTGGG - Intergenic
1095644868 12:44531531-44531553 TTTCATCAGGATTTCCACCTAGG - Intronic
1097683474 12:62670739-62670761 CTTGAGAAGGATTTTCATGTTGG - Intronic
1102486669 12:113263046-113263068 ATACAGCAGCATGTGCATGTGGG + Intronic
1109893196 13:68646021-68646043 TTTCAGCATGATTTATATGTAGG - Intergenic
1110791793 13:79593754-79593776 ATTCAGCTGGATTCCCAGGGAGG - Intergenic
1111075932 13:83235596-83235618 ATTCAGCAGTCTTTGCAGGTAGG + Intergenic
1113356685 13:109587829-109587851 AGTCAGCAGGATTGGCCTGTGGG - Intergenic
1122230728 14:100305408-100305430 ATTCACCAGGATTTAGATGTCGG - Intronic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1125985671 15:44049041-44049063 TTTTAGCAGGGTTTCCCTGTTGG - Intronic
1126986161 15:54312141-54312163 ATTCAGCAGTATTTCCTGCTGGG + Intronic
1127517044 15:59706190-59706212 ATGCACCAGGATTTCCAGTTTGG - Intergenic
1130028372 15:80289721-80289743 ATTCAGCAGGCTTTCCCTGCAGG - Intergenic
1133319986 16:4907378-4907400 ATTCAGCAGACGTTCCTTGTAGG + Intronic
1134907375 16:17991865-17991887 ATTCAGGAGGATTTTCCTGAAGG + Intergenic
1134907848 16:17996544-17996566 ATTCTGCAAGATTTCTATATTGG - Intergenic
1136601686 16:31296306-31296328 TTTCACCATGATTTCCAGGTTGG + Intronic
1140128803 16:72139514-72139536 ATTCATCAGGCATTCCCTGTGGG + Intronic
1140245266 16:73242656-73242678 ATCCAGCAGCATTTCCCTGTGGG - Intergenic
1140817649 16:78635769-78635791 CTTGAGCTGGATGTCCATGTTGG + Intronic
1141967894 16:87459291-87459313 GTTAAGGATGATTTCCATGTGGG + Intronic
1141968800 16:87465739-87465761 ATGCAGCAGCATTATCATGTGGG - Intronic
1143852250 17:9821800-9821822 ATTCAGCGGGGGTTCCATGTGGG - Exonic
1155121600 18:22826469-22826491 ATTCAACAGGACCTCAATGTAGG + Intronic
1157073958 18:44444282-44444304 ATTGAATAGCATTTCCATGTAGG + Intergenic
1158383072 18:56956812-56956834 AGTCTGCAGGATATGCATGTAGG - Intronic
1159328530 18:66956170-66956192 ATTCATCAGGAAAGCCATGTGGG - Intergenic
1167389131 19:49182597-49182619 ATTCAGCAGGGCGTCCATGAGGG - Exonic
1168679478 19:58304064-58304086 ATTCTGGAAGATGTCCATGTTGG - Intronic
928275589 2:29897550-29897572 TTTCAGCAGGATTTCCCTGATGG + Intronic
929944605 2:46361009-46361031 ATCCAGGGGGATGTCCATGTGGG - Exonic
930365252 2:50431475-50431497 ATTCAGCAGGCTTAACCTGTAGG - Intronic
931271355 2:60706202-60706224 ATTCAGCATGACTTCAAGGTTGG - Intergenic
933888662 2:86744209-86744231 ATACATCAGGAATTCCGTGTAGG + Intronic
934204111 2:89911052-89911074 ATTCAGAAGGTTTTGCATGGGGG + Intergenic
936069718 2:109357838-109357860 ATGCAGGAGGCTTTGCATGTAGG - Intronic
937107699 2:119333715-119333737 TTTTGGCAGGATTACCATGTAGG - Intronic
939821828 2:146967126-146967148 AAACAGCAGGATGACCATGTAGG + Intergenic
941164767 2:162073566-162073588 AGGCAGCAGGATTTGCAGGTGGG + Intronic
942468280 2:176231801-176231823 ATGCATCAGGATTTTCATGATGG + Intergenic
945099541 2:206251436-206251458 ATTCACCAGTCTTTCCATCTTGG + Intergenic
945269806 2:207926627-207926649 ATTCAGCAGGACCGCCATCTGGG + Intronic
947881401 2:233517161-233517183 ATTCAGTAGAATGGCCATGTTGG + Intronic
1169840255 20:9928067-9928089 ATTGGGCAGGATTAGCATGTAGG + Intergenic
1170113577 20:12831909-12831931 ATTCAGCAGGATTTGTCTCTAGG - Intergenic
1170437397 20:16344731-16344753 ATTTGGAAGGATTTCCAAGTAGG - Intronic
1172419914 20:34807489-34807511 ATTCAGCAGGATTTCCATGTAGG - Intronic
1173780392 20:45751707-45751729 CTTCAGTGGGATTTGCATGTAGG + Intronic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175577497 20:60072498-60072520 ATTCAGTATGATCTCAATGTGGG - Exonic
1177228945 21:18294156-18294178 AAACAGCAGGATTTCCCTGGTGG + Intronic
1178617479 21:34146461-34146483 TTTCAGCAGGAGTTCAATGTGGG + Intergenic
1182206169 22:28629609-28629631 ATACTGCTGGATTTTCATGTAGG + Exonic
1182909823 22:33972828-33972850 GTCCAGCAGGACTGCCATGTAGG + Intergenic
1182960704 22:34471973-34471995 AATGAGCAGGATTTGCATCTTGG + Intergenic
949710054 3:6862018-6862040 ATTCGGCAGGATCTCCAGGGAGG - Intronic
949710832 3:6869151-6869173 AATTATCAGAATTTCCATGTAGG + Intronic
951266487 3:20573939-20573961 ATTCACCATCATTTCCATGTAGG - Intergenic
951995073 3:28718474-28718496 ATTCAGAAGGATTTTCTTTTTGG + Intergenic
952169371 3:30789619-30789641 ATTAAACAGGTTTTCAATGTAGG - Intronic
956869630 3:73404095-73404117 ATTAAGAAGTATTTCCAAGTTGG - Intronic
958795152 3:98699313-98699335 ATCCAGCAGGTATTCCCTGTGGG - Intergenic
959257680 3:104035630-104035652 ATTCAGCAACACTTCTATGTAGG + Intergenic
959720926 3:109488042-109488064 ATTCAGAAAGATTTCCAGATGGG + Intergenic
960145450 3:114196062-114196084 TTTGAGCAGGATGGCCATGTTGG + Intronic
960479094 3:118166975-118166997 ATTCACCAGTATAGCCATGTGGG + Intergenic
961113369 3:124304986-124305008 CTTAGGCAGAATTTCCATGTTGG + Intronic
961975537 3:131020917-131020939 ATTCAGTTGGATTTCCATGTGGG + Intronic
963554888 3:146774386-146774408 TATCAGCAGGTTTTCCATTTTGG + Intergenic
964627210 3:158771218-158771240 ATTCAGCAGCATTTCCAAACTGG - Intronic
967345532 3:188451358-188451380 ATTCAGCAGGGTTTCTGAGTGGG + Intronic
970117629 4:12716993-12717015 ATGCAGCAGGATCTCAAAGTGGG - Intergenic
971264380 4:25085094-25085116 CTTCAGCAGGATGTCTATGGAGG + Intergenic
974658528 4:64856449-64856471 TTTCAGCAGCATTTCCTTATAGG - Intergenic
977032640 4:91905971-91905993 ACTCTGCAGAATCTCCATGTGGG - Intergenic
978294228 4:107184617-107184639 TTTCTTCAAGATTTCCATGTAGG + Intronic
982998039 4:162376147-162376169 ATCCAGCAGGACTTACATGATGG + Intergenic
999235037 5:150085545-150085567 GTTCTGCAGAATTTCCATCTGGG - Intronic
1000756186 5:165163156-165163178 ATTCAGAAGAATTTCAATATTGG - Intergenic
1001491247 5:172157030-172157052 AATCAACAGTCTTTCCATGTTGG - Intronic
1002513721 5:179741216-179741238 CTCCAGCAGGACTTCAATGTTGG - Intronic
1003907321 6:10713991-10714013 TTTCACCAGGTTTTCCAGGTTGG - Intergenic
1004226521 6:13789743-13789765 AATCAGCAGGTTTTCTAGGTAGG + Exonic
1009437894 6:63638324-63638346 ATTCACCAGTTTTTCCAAGTAGG - Intronic
1013831049 6:114273210-114273232 ATTCATCAGGATTACCTTGTTGG - Intronic
1014510300 6:122312755-122312777 ATGCAGCAGGACTTCTTTGTAGG - Intergenic
1015950217 6:138545637-138545659 ATTCTGCAGCAGTTCCATGGAGG + Intronic
1021325226 7:19258165-19258187 ATCAAGCAGGCTTTCCTTGTGGG + Intergenic
1022897079 7:34761278-34761300 ATCCTTTAGGATTTCCATGTTGG + Intronic
1030758290 7:113317629-113317651 ATTAAGCAGGCTTAACATGTGGG + Intergenic
1033026178 7:137774993-137775015 ATTCAGCAGTTTTTCCAGGCAGG + Intronic
1034435330 7:151060389-151060411 ATTCCGCAGCTCTTCCATGTGGG - Intronic
1034697692 7:153068659-153068681 CTTCAGAAGGATTACCATGAAGG - Intergenic
1034861188 7:154596094-154596116 ATTCAGTAGGATTTGCACTTTGG + Intronic
1039163254 8:34646408-34646430 GCTCAGCACGATTCCCATGTGGG - Intergenic
1041148841 8:54910839-54910861 ATATAGCAGGAAGTCCATGTAGG + Intergenic
1042448541 8:68918240-68918262 AATCAGCAGGACCTCCCTGTGGG + Intergenic
1042694947 8:71546419-71546441 TAACAGCAGGATGTCCATGTTGG - Intronic
1042715116 8:71764127-71764149 ATTCAGCAAGAATTCCAATTCGG - Intergenic
1048625696 8:136182651-136182673 CTTCAGCAGGAATTCCCTTTCGG - Intergenic
1055900706 9:81231961-81231983 ATTCAGCAAGAATACCATCTGGG + Intergenic
1057471769 9:95363508-95363530 ATTCTGTAGGATTCCTATGTGGG + Intergenic
1060250998 9:121986682-121986704 AGCCAGCAGGATTTCCAGGCAGG - Intronic
1060724364 9:125997325-125997347 ATTCAGCACGTGTTCCATGAGGG - Intergenic
1062021963 9:134323989-134324011 ATGCAGACAGATTTCCATGTGGG - Intronic
1186684980 X:11916514-11916536 GTTCAGCATGAATTACATGTGGG + Intergenic
1186698571 X:12065085-12065107 ATTCAATAGGATTTGCAAGTAGG - Intergenic
1186857084 X:13636895-13636917 ATTCACCAGGATGTCCCTATGGG + Intergenic
1189579381 X:42389584-42389606 ATTCACCAGCATTTCCCTGAGGG - Intergenic
1192528004 X:71864169-71864191 CTTCAGCAGATTCTCCATGTTGG - Intergenic
1196190773 X:112791976-112791998 TTTCAGCTGGAAATCCATGTTGG + Exonic
1196715299 X:118805274-118805296 AAACAGCAGGAGTTCCATCTAGG - Intergenic
1198131127 X:133696144-133696166 ATTCAGAAGGTTTTCCATAAAGG - Intronic
1198362672 X:135911118-135911140 CATCAGCAGGATATCCCTGTGGG + Intronic
1201751718 Y:17439390-17439412 ATTCAACAGTTTATCCATGTAGG - Intergenic