ID: 1172420419

View in Genome Browser
Species Human (GRCh38)
Location 20:34812311-34812333
Sequence AGCTGCACAAATTTTCCCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172420419_1172420423 14 Left 1172420419 20:34812311-34812333 CCCAAGGGAAAATTTGTGCAGCT 0: 1
1: 0
2: 0
3: 17
4: 174
Right 1172420423 20:34812348-34812370 GAGAAACTTAATGCTCTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172420419 Original CRISPR AGCTGCACAAATTTTCCCTT GGG (reversed) Intronic
901348492 1:8569109-8569131 TGAAGCACAAATTTTCTCTTTGG + Intronic
901799358 1:11698529-11698551 ATCTGCCCAACTTTTCCCTCTGG - Intronic
903027472 1:20439643-20439665 AGCTTCTCAAATTTTCCCTAGGG - Intergenic
906145159 1:43556151-43556173 AGCTGCACATGTTTTCACATTGG + Intronic
906777447 1:48542623-48542645 AGCTGCATAAATTTCTTCTTTGG + Intronic
907210125 1:52813984-52814006 AGATGCATAATTTTTCCCTCAGG + Intronic
908716360 1:67074142-67074164 AGTGGCACAAATTTTCACATTGG + Intergenic
910482407 1:87673034-87673056 ACCTTCACAATTTTTCCCCTAGG + Intergenic
912307754 1:108587699-108587721 AGCTACACAAAATTTTCCTACGG - Intronic
913346373 1:117814993-117815015 AGCTGCACAAATTCTACCCCTGG + Intergenic
914838368 1:151227084-151227106 AGGGACACATATTTTCCCTTTGG - Intronic
914973219 1:152330797-152330819 ACCTGCAGAAATTTTCCCTCTGG - Intergenic
915263286 1:154695027-154695049 ATCTTAACAAATTTACCCTTAGG - Intergenic
918297123 1:183167462-183167484 AGCTTCACAAATCCTCACTTAGG - Intergenic
919856767 1:201711474-201711496 AGATTCAGAAATGTTCCCTTTGG + Intronic
920998092 1:211014480-211014502 AGCTGCACAAGTGATCCCTTTGG - Intronic
921143163 1:212325287-212325309 TTCTCCACAAAATTTCCCTTAGG - Intronic
922597997 1:226828379-226828401 AGTGGCACAATTTTTCCTTTTGG - Intergenic
1062760633 10:14366-14388 AACTGCACAAATTATGCTTTGGG - Intergenic
1068192774 10:53673826-53673848 AGCTGCAAACATTTTCCGTATGG - Intergenic
1068825445 10:61433451-61433473 AGCTTCAAAAATATTCCTTTGGG + Intronic
1068950122 10:62768423-62768445 AGTTGCTCAAATTTGCCCTTTGG - Intergenic
1072746575 10:97943840-97943862 AGCTGAAAATATTTTCCATTTGG + Intronic
1073865066 10:107793080-107793102 AACTACACAAATTTTCTCTGAGG + Intergenic
1074566355 10:114581828-114581850 AGATGTACTAATTTACCCTTAGG + Intronic
1075144763 10:119873317-119873339 AGCTGCACAAGGTCTCCCTGAGG + Intronic
1076046868 10:127301118-127301140 AGCTTCACAAATCCTCCCCTTGG - Intronic
1076272294 10:129164514-129164536 AGCTGAACATCTTTTCCTTTAGG - Intergenic
1078575143 11:12495283-12495305 ACCTGCATAAATTCTCCATTGGG + Intronic
1080176096 11:29365083-29365105 AGATCCAAAAATTTTCCCTTGGG + Intergenic
1080386970 11:31816129-31816151 CGCTGCACAAACTTTCCCGCGGG - Intronic
1080480551 11:32645140-32645162 ACCTCCACATATTTTCCCTCTGG + Intronic
1081702647 11:45161695-45161717 AGCTGCACCAATTTGCCCCCGGG - Intronic
1085643462 11:78207833-78207855 TGCTGCCCAATCTTTCCCTTTGG + Intronic
1086813792 11:91343848-91343870 AGCTGCTCAACTTTTGCTTTTGG - Intergenic
1087160661 11:94945075-94945097 AGATGCACTAATTTTCCTGTTGG + Intergenic
1087826723 11:102772903-102772925 AGCTGCATCAATTTTCCTTATGG + Exonic
1088132915 11:106517082-106517104 TCATGCACAAATTTTACCTTTGG + Intergenic
1089720888 11:120420048-120420070 AGAAACACAAATTCTCCCTTAGG + Intronic
1090265865 11:125352480-125352502 TGCTGCACAAATCTTCCGTGTGG - Intronic
1090909884 11:131109730-131109752 AGCAGCAGAAATTTGACCTTAGG + Intergenic
1092719048 12:11422536-11422558 ATCTGCAGAAATATTCCATTAGG + Intronic
1092795001 12:12101608-12101630 ACCTGCAGATATTTCCCCTTAGG + Intronic
1093319389 12:17694350-17694372 AGCTGTAGAAATATTCCCTTAGG + Intergenic
1094749095 12:33384702-33384724 AGATGCACAAATTTTTAGTTAGG + Intronic
1097529534 12:60780956-60780978 AGCCGCACAGATTTTCGCTTGGG - Intergenic
1098334832 12:69392568-69392590 AGATGAAGAAATTATCCCTTGGG - Intergenic
1099073826 12:78080440-78080462 ACCTGCATAAATGTTCTCTTTGG + Intronic
1099599876 12:84720813-84720835 AGCTGCACAAAATTACCCCTTGG - Intergenic
1100682925 12:96948620-96948642 AGATGCACAGATTTCCACTTAGG - Intronic
1100721533 12:97364237-97364259 AGCTACACAGATGTTCCCTGAGG - Intergenic
1102167680 12:110819727-110819749 AGCAGCACAAATTGTCCCTGAGG + Intergenic
1103157333 12:118697252-118697274 AGCTGCACAAACTTTTCTATTGG + Intergenic
1105594469 13:21823764-21823786 ACCTGCAAAAATTTTGGCTTTGG + Intergenic
1106108222 13:26753449-26753471 ATCAGAACACATTTTCCCTTAGG + Intergenic
1106188563 13:27429277-27429299 AGAGGCACAAATTTTCTTTTGGG + Intronic
1109013406 13:56977896-56977918 ACCTGCACCAGTTTTCCCTGAGG + Intergenic
1109171589 13:59104763-59104785 AACTTCAGAAAATTTCCCTTTGG + Intergenic
1110711980 13:78659880-78659902 AACCTCACAAATTCTCCCTTGGG - Intergenic
1112558512 13:100491563-100491585 AGCTGCAAAATGTTGCCCTTGGG + Intronic
1116284062 14:42949603-42949625 AGCTGGAACCATTTTCCCTTAGG + Intergenic
1124460876 15:29890498-29890520 AGCTGTCCATTTTTTCCCTTAGG - Intronic
1127332541 15:57952967-57952989 AGCTGCAAAAATATTCCATCAGG + Intergenic
1127587177 15:60389567-60389589 AGCCCCACAAATCTTCCTTTCGG + Intronic
1128243577 15:66118007-66118029 CTCTGCCCAAATTTTCCCTCTGG + Intronic
1128779455 15:70349318-70349340 AGGTGGAGAAATTTGCCCTTAGG + Intergenic
1130167764 15:81481140-81481162 ATCTGCACAACTTTTACCTCTGG + Intergenic
1130173921 15:81547736-81547758 AGCTGCACATATTTCACCCTTGG + Intergenic
1133974273 16:10589275-10589297 AGCTGCCCTAAGCTTCCCTTTGG - Intergenic
1135864685 16:26090496-26090518 GGGTGCACAAAATTTCCCATGGG + Intronic
1135877420 16:26216030-26216052 GGCTTCTCAAGTTTTCCCTTGGG - Intergenic
1138000739 16:53276601-53276623 TGCTGCACAAGGTTTGCCTTAGG - Intronic
1139685955 16:68603924-68603946 AGATACACAAATTTTCACTCTGG + Intergenic
1143330672 17:6132721-6132743 AGGTGCACAATTTTTGTCTTGGG - Intergenic
1147119662 17:38328495-38328517 AGCTGCCGACATTTGCCCTTTGG - Exonic
1147174816 17:38648373-38648395 AGCTTAATAAATTTTCCCATAGG - Intergenic
1149114713 17:53079136-53079158 AGCTGCACAAAATGTCGATTTGG - Intergenic
1152953540 18:14720-14742 AACTGCACAAATTATGCTTTGGG - Intergenic
1153423208 18:4931999-4932021 AGCTGTTCAAATTGTCCCTGGGG + Intergenic
1154109968 18:11559415-11559437 AGGTGCACAGATTTTTCCTTTGG - Intergenic
1157024337 18:43824983-43825005 AGCTTCACACATCTTCCCCTGGG + Intergenic
1158847896 18:61463855-61463877 AGGGGCACATATTTTCCCATTGG - Intronic
1159829509 18:73257622-73257644 AGATGCTCAAATGTGCCCTTAGG + Intronic
1159829645 18:73259226-73259248 AGATGCTCAAATGTGCCCTTAGG - Intronic
1163793927 19:19324792-19324814 AGCTGGAAAAATTTTCAGTTGGG - Intronic
1164503959 19:28842692-28842714 AGCTGCATAATATTTCACTTCGG - Intergenic
1168506838 19:56942820-56942842 AGCTTCAAAAATATTCTCTTCGG + Intergenic
925762284 2:7196914-7196936 AGCAATGCAAATTTTCCCTTTGG + Intergenic
926673654 2:15600563-15600585 CCCTGCATAATTTTTCCCTTGGG + Intronic
928855230 2:35795539-35795561 AGCAACTCAAATTTTCCCTGAGG + Intergenic
930246885 2:48992648-48992670 AGCTCCACCAATTGTCCCCTGGG - Intronic
930672488 2:54165769-54165791 AGATGCACTGACTTTCCCTTGGG - Intronic
932054742 2:68432849-68432871 AGCACCACAAGTTCTCCCTTGGG + Intergenic
933977693 2:87525166-87525188 AGCTTCACATTTGTTCCCTTTGG + Intergenic
940436454 2:153662022-153662044 CACTGCACAGATCTTCCCTTTGG + Intergenic
940436574 2:153663620-153663642 AGCTGCAGAAAATTTTTCTTTGG - Intergenic
941059960 2:160835848-160835870 GGATGCACAAATTTTCTTTTTGG - Intergenic
942183822 2:173405558-173405580 AGCTCCACAAATCCTCCCCTGGG - Intergenic
944297583 2:198084413-198084435 AGCTTCACAAAATTCCTCTTCGG - Exonic
945607512 2:211953751-211953773 AGCAAAACAAATTGTCCCTTGGG - Intronic
948355501 2:237374158-237374180 AGCTGCACATATGTCCCTTTTGG + Intronic
1169705341 20:8497151-8497173 AAATGCACAAATTTTTACTTAGG + Intronic
1169942764 20:10954945-10954967 AGCTGAATATATTTTCTCTTGGG + Intergenic
1172420419 20:34812311-34812333 AGCTGCACAAATTTTCCCTTGGG - Intronic
1179296368 21:40066240-40066262 AGCTGCACAAAGATTTCCTGAGG + Intronic
1179838007 21:44050323-44050345 AGCTGCTCTAATGTCCCCTTGGG + Intronic
1181868415 22:25877863-25877885 AACGGCACAAAGTTTCCGTTAGG - Intronic
1185261743 22:49869513-49869535 AGCAGTACAAATATTCCCTGAGG - Intronic
953200074 3:40770715-40770737 TGCTGCAAAAATTTTCCCAGAGG + Intergenic
953579042 3:44136799-44136821 ACCTCCTCATATTTTCCCTTTGG - Intergenic
956201530 3:66711230-66711252 AGCCTTACAATTTTTCCCTTAGG - Intergenic
957809935 3:85208383-85208405 AGCTGCTCTACTTTTCCCTATGG - Intronic
958147853 3:89649770-89649792 AGCTGTGCAAACTTTCCCCTTGG + Intergenic
960731150 3:120728477-120728499 TTCTGGACAAATTTTCCCTTTGG - Intronic
961903381 3:130237215-130237237 AACTGTACAAAGTTTCCCTTGGG - Intergenic
965306866 3:167076047-167076069 ATAAACACAAATTTTCCCTTTGG - Intergenic
966273543 3:178137672-178137694 AGATGTACAAATTTACTCTTTGG - Intergenic
966387159 3:179411177-179411199 AGTTGCTGAAATTTTCCATTTGG - Intronic
968280470 3:197473138-197473160 TGCTGACCACATTTTCCCTTGGG + Intergenic
968905976 4:3450707-3450729 AAATGTACACATTTTCCCTTTGG + Intergenic
970155726 4:13140078-13140100 TGCTCCACAAATTTTACCTACGG + Intergenic
971120786 4:23702342-23702364 AGCAGCACAAAATTTCACTTTGG - Intergenic
978150185 4:105425467-105425489 AGGTTCACTAATTTTCTCTTTGG - Intronic
978785593 4:112605991-112606013 TTCTTCACAAATTTTACCTTAGG + Exonic
979308163 4:119172595-119172617 ACCTCCCCAAATTTTTCCTTGGG - Intronic
979364108 4:119800022-119800044 ATCTGCAGAAATTTTCTCTTGGG + Intergenic
980466011 4:133182825-133182847 AGCGTAATAAATTTTCCCTTAGG - Intronic
980753554 4:137125555-137125577 AGCTTAATAAATTTTCTCTTAGG + Intergenic
980874168 4:138644035-138644057 AAAAGCACAAATTTTCCCTGTGG - Intergenic
980989766 4:139729203-139729225 AGCAGTACAATTTTTCTCTTTGG + Intronic
982345647 4:154354940-154354962 AGCTTCCTAAATTTTCACTTAGG - Intronic
982641241 4:157964286-157964308 TGGTGCACATATTTGCCCTTTGG - Intergenic
983066369 4:163214182-163214204 AGCTACACAAACTTTCTTTTAGG + Intergenic
983076653 4:163334444-163334466 AGTTTCACAAATTTTCCTTAGGG - Intronic
983809367 4:172039602-172039624 AGCTGCAAAAATTTTCCAAGAGG + Intronic
984097591 4:175451138-175451160 ACTTACCCAAATTTTCCCTTTGG + Intergenic
986365797 5:7029355-7029377 AGCAGCAAAAATTTTCCCATTGG - Intergenic
989260406 5:39413169-39413191 AGTTGCACAGACTTGCCCTTTGG + Intronic
989487428 5:42008396-42008418 GCCTGCCCAAATTTACCCTTAGG - Intergenic
991174035 5:63665098-63665120 TGCTGGACAAATTTTGCCCTTGG + Intergenic
994556537 5:101314008-101314030 ACCTGGTTAAATTTTCCCTTGGG + Intergenic
994901900 5:105783764-105783786 AGCTGTAAAAATATTCCCTCTGG - Intergenic
995358031 5:111261909-111261931 TGCTGCACAAGTTTTGCCTCTGG - Intronic
997084165 5:130776803-130776825 AGCTACACACATTTTCACTGAGG - Intergenic
997604888 5:135167772-135167794 AGCTGCCCCAACTTTCCCCTGGG - Intronic
998626406 5:143851689-143851711 AGATGAACTGATTTTCCCTTTGG + Intergenic
999799850 5:155023322-155023344 AGTGGAACAAATTTTCCTTTGGG + Intergenic
1005590943 6:27326510-27326532 ATTTGCACAAATTTTGCATTGGG + Intergenic
1008764111 6:54890292-54890314 AGCTGCACAATTTTTCAACTTGG - Intronic
1011742469 6:90376215-90376237 AGTCTCACAAATTTCCCCTTTGG + Intergenic
1013214622 6:108015901-108015923 AGCTGGAGACATTTTCCCTACGG + Intergenic
1013676924 6:112475267-112475289 AACTGCAAACATTTTCCCATGGG + Intergenic
1014908866 6:127064729-127064751 AGCTACACAAGTTTCCTCTTAGG + Intergenic
1015474732 6:133647773-133647795 AGCAGCATGAATTTTGCCTTTGG - Intergenic
1017813187 6:157999007-157999029 GGCTGCACAAACTTTCCTTCTGG - Intronic
1017945791 6:159095315-159095337 ACCTGCACCATTTTTCTCTTTGG - Intergenic
1019662370 7:2232189-2232211 AGCTGCAGAAGTTCTACCTTTGG - Intronic
1020937563 7:14486413-14486435 AGCTCCTCACATTGTCCCTTTGG - Intronic
1021396278 7:20152398-20152420 AGCTGTATAATTTTTCTCTTTGG - Intronic
1023320588 7:38993541-38993563 TGCTAGACAGATTTTCCCTTAGG - Intronic
1024557904 7:50619348-50619370 AGTTGAACAAATCTTCCATTTGG - Intronic
1027997841 7:85448404-85448426 TGGTGCACATATGTTCCCTTAGG + Intergenic
1030342404 7:108395091-108395113 AGCTGAATTCATTTTCCCTTGGG - Intronic
1031440066 7:121783369-121783391 ATCTATACAAATATTCCCTTTGG - Intergenic
1031648327 7:124254541-124254563 ACTTGGACAAAATTTCCCTTTGG + Intergenic
1032735753 7:134691379-134691401 AAAGGCACAAATTTTCCATTGGG + Intergenic
1033218916 7:139514909-139514931 AAGGGCACAAAGTTTCCCTTAGG - Intergenic
1035265323 7:157687062-157687084 AGCTCCACAAATTGTCTCTGTGG - Intronic
1036064401 8:5363036-5363058 AGGTGCACAAAGTCTCTCTTGGG + Intergenic
1036219267 8:6907543-6907565 AGCTTTACAAATTTTGACTTTGG + Intergenic
1037420067 8:18692717-18692739 AGCTGCAAGAATTGTCACTTTGG + Intronic
1037635155 8:20695007-20695029 ACCTGCGCACATTTTCCCTCTGG + Intergenic
1037948144 8:23002199-23002221 AGCTGCACATATTTTGTATTTGG + Intronic
1039781811 8:40793542-40793564 AGCGTTACAAATTTTCCATTTGG + Intronic
1041795832 8:61747021-61747043 AGATGCAAACATTTTCCATTAGG + Intergenic
1047166824 8:122448612-122448634 AGCTGCCAAAATTCTCCCTTTGG - Intergenic
1047818937 8:128496968-128496990 ATTTGTACAAATTTCCCCTTTGG + Intergenic
1050704590 9:8382774-8382796 AGCAGCACAAACATTGCCTTTGG - Intronic
1050748036 9:8900577-8900599 TGCTCCACCAATTTTCCTTTTGG + Intronic
1051153995 9:14120225-14120247 ATCTTCACAAATGTACCCTTTGG + Intronic
1051413626 9:16816127-16816149 AGCTGCATAAATTTTGCCTGAGG + Intronic
1056329747 9:85511519-85511541 GGCTGTACAAATTCTGCCTTGGG + Intergenic
1059503321 9:114775428-114775450 AACTGCAGAAATCTTCACTTAGG - Intergenic
1061947593 9:133917514-133917536 AGTGGCATAAGTTTTCCCTTTGG - Intronic
1186975891 X:14904543-14904565 AGGTGCTCAAAATTGCCCTTAGG + Intronic
1188576530 X:31657537-31657559 CCCTCCACAAATTTTCCCATTGG + Intronic
1189922528 X:45916317-45916339 AGTAGCACAGAGTTTCCCTTCGG + Intergenic
1191915645 X:66198718-66198740 AGCTGCAGCAGTTTTTCCTTAGG - Intronic
1192911181 X:75606114-75606136 CTCTGCAGAAATTTTCCCTAGGG + Intergenic
1196392361 X:115221455-115221477 CCCTGCACAATTTGTCCCTTTGG - Intronic
1199758074 X:150883315-150883337 ATCTGGACAAATTTTGACTTTGG + Intronic
1200848401 Y:7856164-7856186 AGTTTAAAAAATTTTCCCTTGGG - Intergenic