ID: 1172422999

View in Genome Browser
Species Human (GRCh38)
Location 20:34833660-34833682
Sequence AAGTCGAAAGGAAAGTTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 5, 2: 8, 3: 25, 4: 375}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172422999 Original CRISPR AAGTCGAAAGGAAAGTTGGA CGG (reversed) Intergenic
901715447 1:11149961-11149983 AGGTAGAAAGGACAGATGGAAGG + Intronic
903160614 1:21486407-21486429 AAGATGGAAGGAAAGCTGGATGG + Intergenic
903682873 1:25108778-25108800 AGGACGGAAGGAAAGATGGAAGG + Intergenic
903796042 1:25929648-25929670 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
903927462 1:26840853-26840875 CAGTTGAAGGGAAAGTTGAAGGG - Intronic
904058089 1:27685581-27685603 AAGTAGAAAGGACAGGTGGCAGG - Intergenic
905941116 1:41864179-41864201 AAACCCAAAGGAAATTTGGAAGG - Intronic
907832421 1:58077721-58077743 AAGGAGAAAGGAAAGATTGACGG + Intronic
908629062 1:66082029-66082051 AATACAAAAGGAGAGTTGGAAGG + Intronic
909024824 1:70469611-70469633 AAGTCCAAAGGGAAGTCTGATGG - Intergenic
909052982 1:70789782-70789804 AAGACCAAAGGAAAGGTGGGAGG + Intergenic
909979578 1:82082694-82082716 AAGTGGAAAAGAAAGGTAGAAGG - Intergenic
910103808 1:83608443-83608465 AATTCTAAAGAAAAGTAGGAAGG - Intergenic
911733690 1:101314965-101314987 AAGTGGAAAGGAAAGCTGAAAGG + Intergenic
912187390 1:107294483-107294505 AAGTGGAAAGGAAAAAAGGAAGG - Intronic
913162317 1:116155395-116155417 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
913502050 1:119480399-119480421 AAGCAGAAAGGAAAGAAGGAAGG + Intergenic
913531448 1:119737027-119737049 CAGGCAACAGGAAAGTTGGAGGG - Intronic
913552350 1:119927910-119927932 AAGTTGGAAGGAAAGATGGCTGG + Intronic
913582894 1:120244781-120244803 GAGGCGAAAGGAAGGGTGGACGG - Intergenic
914564825 1:148856277-148856299 GAGGCGAAAGGAAGGGTGGACGG - Intronic
914608001 1:149273965-149273987 GAGGCGAAAGGAAGGGTGGACGG + Intergenic
914859585 1:151374904-151374926 AAGATGAAAGGAAGGATGGAAGG + Intergenic
915482206 1:156194573-156194595 AAGACCAAAGGAAAGCTGGGTGG + Intronic
916393315 1:164357246-164357268 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
916461107 1:165025395-165025417 AAGTAGCAAGGAAAGAGGGAAGG + Intergenic
917106821 1:171500726-171500748 AGGTCTAAAAGAAATTTGGAAGG - Intronic
917238204 1:172917462-172917484 AAATCAAATAGAAAGTTGGATGG + Intergenic
917238206 1:172917474-172917496 AAGTTGGATGGAAAGATGGATGG + Intergenic
917418366 1:174835209-174835231 AAGTCAGGAGGAAATTTGGAGGG + Intronic
917496711 1:175546982-175547004 AAGTGCAAAGGAAAGAAGGAAGG - Intronic
917659706 1:177164947-177164969 ACGTCGAAAGGAAAGAGGAAGGG + Intronic
918748056 1:188231728-188231750 AAGACTAAAGGAAAGAAGGAAGG - Intergenic
919058864 1:192605997-192606019 AGGAAGAAAGGAAAGTAGGAAGG + Intergenic
919834453 1:201564109-201564131 AAGAAGAAAGGAAAGAAGGAGGG + Intergenic
920081939 1:203381302-203381324 AATAGGAAATGAAAGTTGGAGGG + Intergenic
920821827 1:209388755-209388777 AAAACGAAAGGAAAGAAGGAAGG - Intergenic
920984135 1:210868709-210868731 AGGATTAAAGGAAAGTTGGAAGG - Intronic
922323619 1:224509328-224509350 AAGACGAAAGGAAAGAAGAAGGG + Intronic
923818107 1:237403054-237403076 AAGGAGAGAGGAAAGATGGATGG + Intronic
1062977721 10:1697830-1697852 AAGTCGAAAGAGAAGTTGCAGGG - Intronic
1062979543 10:1710550-1710572 AAGTGGCAAGGACAGTGGGAAGG - Intronic
1064167639 10:13000899-13000921 AAGTCAAAGGGACTGTTGGAGGG + Intronic
1064537181 10:16369582-16369604 AGGTGGAAATGAGAGTTGGAAGG - Intergenic
1064977822 10:21136630-21136652 AAGGCAAAAGGGAACTTGGAAGG - Intronic
1065334944 10:24647476-24647498 AAGACAAAAGAAAAGTAGGAGGG + Intronic
1068533490 10:58214394-58214416 AAGTCAGAAGGAAAGAGGGAGGG + Intronic
1069646762 10:70005273-70005295 AGGAAAAAAGGAAAGTTGGAAGG + Intergenic
1069851583 10:71408852-71408874 CAGTTGAAAGGAAAGTAGGAAGG - Intronic
1070282328 10:75058839-75058861 AAGTCTAAAGAAAGGTGGGAAGG - Intergenic
1071352065 10:84756557-84756579 AAGCCAAAAGAAAAGTGGGAGGG - Intergenic
1073685812 10:105752407-105752429 AAGTGGGAAGGAAAGTTGAGTGG + Intergenic
1074115111 10:110451124-110451146 AAGTCGAAAGGAAAGTTTGATGG + Intergenic
1074736470 10:116439548-116439570 AAGTCGAAAGTAAAGTTTGATGG - Intronic
1075833336 10:125429844-125429866 GAGTGGAAAGGAAGGTGGGAAGG - Intergenic
1075847602 10:125557540-125557562 ATGTTGAAGGGAAACTTGGAGGG - Intergenic
1076602486 10:131667803-131667825 ATGTGAAAAGCAAAGTTGGAGGG - Intergenic
1077789895 11:5427175-5427197 AACTCAAAAGAAAGGTTGGACGG - Intronic
1078175834 11:8969455-8969477 AATTCAAAAGAAAAGCTGGAAGG - Intergenic
1079134646 11:17769503-17769525 AAGGAGAAAGGAAAGGAGGAAGG + Intronic
1079540924 11:21573750-21573772 AAGTAGAAAGAAAAGAAGGAAGG + Intronic
1079680535 11:23291238-23291260 CAGTCCAAAGGAAAGATAGAGGG - Intergenic
1079743660 11:24097763-24097785 AAGGAGAGAGGAAAGGTGGAAGG - Intergenic
1081073355 11:38638025-38638047 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1081471878 11:43381680-43381702 AACTCGAAACCAAAATTGGAAGG + Intronic
1082187015 11:49195405-49195427 AAGTGGAAAGGGAAGTTAAAGGG + Intronic
1082611608 11:55305637-55305659 AAGCCGGAAGAAAAGTAGGAGGG + Intergenic
1082854399 11:57793595-57793617 AAAATGTAAGGAAAGTTGGAAGG - Intronic
1085364550 11:75927699-75927721 AATTAGACAGCAAAGTTGGATGG + Intronic
1085988977 11:81816969-81816991 AAGTAGAAAGGAAAGAAGAAAGG - Intergenic
1086679323 11:89649977-89649999 AAGTGGAAAGGGAAGTTAAAGGG - Intergenic
1086698259 11:89869029-89869051 AAGCCGGAAGAAAAGTAGGAGGG - Intergenic
1086707905 11:89975459-89975481 AAGCCGGAAGAAAAGTAGGAGGG + Intergenic
1086715399 11:90055693-90055715 AAGCCGGAAGAAAAGTAGGAGGG - Intergenic
1086800379 11:91166823-91166845 CAGTGTAAAGGAAATTTGGATGG + Intergenic
1088157003 11:106818574-106818596 AAGTGAAAAGAAAAGTTGCAGGG + Intronic
1090138639 11:124228315-124228337 AAGTCGGAAGGAAGGAAGGAAGG + Intergenic
1090267372 11:125361791-125361813 AAGTCTGAAGGGAAGTTGGCAGG + Intronic
1090560450 11:127926693-127926715 ATGTCGACAGAAAAGTTCGATGG + Intergenic
1091060047 11:132452604-132452626 AAGAAGGAAGGAAAGTAGGAAGG - Intronic
1091929852 12:4386852-4386874 AAGTTGAAAAAAAAGTTGGGGGG + Intergenic
1093877936 12:24372078-24372100 AAGACCTAAGAAAAGTTGGAAGG - Intergenic
1094067177 12:26373613-26373635 AATTCAGAAGGAAACTTGGAGGG + Intronic
1094849094 12:34374364-34374386 AAGGCGAAAGGAAGGTTGAAAGG - Intergenic
1095418556 12:42001293-42001315 AAGTCTAGAGGAAAGTTCCAAGG - Intergenic
1095544380 12:43347578-43347600 AACTGAAAAGGAAAGTTGCATGG - Intergenic
1095798202 12:46244172-46244194 AAGAAGAAAGGAAAGTAGAACGG + Intronic
1098245947 12:68517983-68518005 AAGAAGAAAGGAAAAATGGATGG + Intergenic
1098389696 12:69956541-69956563 AAGAAGAAAGGAAATGTGGAGGG - Intronic
1099487873 12:83250162-83250184 AAGTCGACATGAGATTTGGATGG - Intergenic
1100011658 12:89961236-89961258 AAGTGGAGAGGATAGATGGAGGG - Intergenic
1101937520 12:109070160-109070182 AAGCCGAGAGGAAAGGTGGGAGG + Intronic
1102402239 12:112639634-112639656 AACTTGAAATGAAAGTTGAAGGG + Intronic
1103246752 12:119464419-119464441 AAGAAGAAAGGAAAGATGGAAGG - Intronic
1103714505 12:122936349-122936371 AATTCAAAAGGTAAGGTGGAGGG + Intronic
1104222277 12:126796582-126796604 AAGGAGAAAGGGAGGTTGGAAGG - Intergenic
1105981833 13:25524930-25524952 AAGACGGAAGGAAAGAAGGAAGG - Intronic
1106594343 13:31123788-31123810 AAGGAGAAAGGAAGGTAGGAGGG - Intergenic
1107343144 13:39431528-39431550 AAGTAATAAGAAAAGTTGGAAGG - Intronic
1108046487 13:46388509-46388531 AAGTAGAAAGGAAGGAAGGAAGG + Intronic
1108331954 13:49395813-49395835 AAATGGAAAGGAGAGTTGGCAGG + Intronic
1108405470 13:50096510-50096532 AAGAAGAAAGGAAAGGTGAAGGG - Intronic
1108411194 13:50148901-50148923 AAGAAGAAAGGAAGGTGGGAAGG - Intronic
1109022384 13:57114691-57114713 GAGTCGAAAGGAAGGAAGGAAGG + Intergenic
1109099399 13:58161277-58161299 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1109263365 13:60169028-60169050 AAGTGGAAAGGCAAGGTGGAGGG - Intergenic
1109468075 13:62764810-62764832 ATGTGGAAAGGATAATTGGATGG + Intergenic
1109496627 13:63180301-63180323 AAATAGAAAGGCAAGGTGGAAGG - Intergenic
1109698787 13:65997373-65997395 AAGGAGAAAGGAAAGTTGCTTGG - Intergenic
1109988634 13:70023637-70023659 AACAAGAAAGGAAAGTTTGAAGG - Intronic
1110667100 13:78129831-78129853 AAGGAGAAAGGAGAGCTGGAGGG - Intergenic
1112684041 13:101802332-101802354 AAGTGTAAAGGAGAGTTTGATGG + Intronic
1114764630 14:25356852-25356874 GATTTGAAAGAAAAGTTGGAAGG + Intergenic
1114878927 14:26759570-26759592 AATTCGAGATGAAACTTGGATGG + Intergenic
1115301270 14:31888130-31888152 AAGACGGAAGGAAAGACGGAAGG - Intergenic
1115301272 14:31888142-31888164 AAGACGGAAGGAAAGACGGAAGG - Intergenic
1115644338 14:35357388-35357410 AAGGGGAAAGGAGAATTGGAAGG + Intergenic
1116007178 14:39306586-39306608 AATTCAACATGAAAGTTGGATGG + Intronic
1116075034 14:40100751-40100773 AAGGAAAAAGGAAAGTTGGTTGG - Intergenic
1117575144 14:57090514-57090536 AAATAGAAAGGAAAGATGGAAGG - Intergenic
1118039430 14:61901039-61901061 AAGTCAGAAGGGAAATTGGAAGG - Intergenic
1118137784 14:63046916-63046938 AAGGCGAAAAGATAGTTGGATGG + Intronic
1120277078 14:82389604-82389626 AAGTAGAAAGAAAAGTGGGTGGG - Intergenic
1120847286 14:89137837-89137859 TTGTTGAAAGGAAAGCTGGAGGG - Intronic
1122389947 14:101373381-101373403 CAGCAGAAAGGGAAGTTGGAGGG - Intergenic
1122670014 14:103364327-103364349 AAGTCTAAAGGAAACTTTGATGG - Intergenic
1123756664 15:23402281-23402303 AAGGAGAAAGGAAAGAAGGAAGG + Intergenic
1127193430 15:56558347-56558369 AAGTTCAAAGGAAAGAAGGAAGG - Intergenic
1127324702 15:57883766-57883788 AAGTAGAGAAGAAAGTTGGGGGG - Intergenic
1129947562 15:79553414-79553436 AAGTGGAAAGGAAAAGTGTAAGG + Intergenic
1131933590 15:97475267-97475289 AAGTTAAAAGTAAAGTTGGAAGG - Intergenic
1132084664 15:98897882-98897904 AAGTTGAAAGGAATTTTGGGGGG + Intronic
1132984266 16:2756135-2756157 TGGTAGAAAGGAAATTTGGAAGG + Intronic
1133969330 16:10556214-10556236 AAGAAGGAAGGAAAGATGGAGGG - Intronic
1134459672 16:14420459-14420481 AAGGAGAAAGGAAAGAAGGAAGG - Intergenic
1135895388 16:26396407-26396429 AAGTGGAAAGCAAGGTGGGATGG - Intergenic
1137799430 16:51248540-51248562 AAGAGGAAAGGAAAGAAGGAAGG - Intergenic
1137842953 16:51656854-51656876 AAATGTCAAGGAAAGTTGGATGG - Intergenic
1138231110 16:55336978-55337000 AGGTCGAGATGAAAGTTGCAAGG + Intergenic
1138378107 16:56580935-56580957 AAGAAGAAAGGAAAGAGGGAAGG - Intergenic
1138525466 16:57603611-57603633 AAGTCTGAAGGAAAGTTCGATGG + Intergenic
1138963016 16:62050432-62050454 AAGTAGAAAGGAAAATGGGGAGG - Intergenic
1140414122 16:74761105-74761127 AAGTTAAAATAAAAGTTGGAAGG + Intronic
1140708687 16:77656155-77656177 AAGTAGAAAGGGAAGTTGAAGGG + Intergenic
1141055261 16:80807827-80807849 AAGCCTAAAGGAATGGTGGAAGG + Intergenic
1141388339 16:83643840-83643862 AAGTGGACAGGAAACTTGGGGGG - Intronic
1144086913 17:11818127-11818149 AAGTCCATAAGAAAGTGGGATGG + Intronic
1144118522 17:12126152-12126174 AATTCGAAATGAAATTTGGGTGG + Intronic
1145266202 17:21380719-21380741 ATGTCCAAGGGAAGGTTGGATGG - Intronic
1145831531 17:27920417-27920439 AAGGAGCAAGGAAAGATGGAAGG - Intergenic
1146805274 17:35859983-35860005 AAGTAGAAAGGAAGGGTGTATGG - Intronic
1146932452 17:36787076-36787098 AAGAAGAAAGGAAGGATGGAAGG + Intergenic
1147642755 17:42014460-42014482 AAATCAAAAGGAAAATTGGCTGG - Intronic
1147737380 17:42648655-42648677 AAGTCGAAAGGAAAGTCTGATGG + Intergenic
1148557423 17:48586866-48586888 AAGTCGAAAGGAAGGTGAGGGGG + Intronic
1148835936 17:50465773-50465795 CTGTCGAAGGGGAAGTTGGAGGG + Exonic
1150263768 17:63818380-63818402 AAGTCGATGGGACAGTTAGAGGG + Exonic
1150979419 17:70124968-70124990 AAAAAGAAAGGAAAGTTGGCTGG + Intronic
1151082959 17:71349477-71349499 AATTCGACAGGAAATTTGGGTGG + Intergenic
1154220677 18:12450923-12450945 AAGTTGAAAGGAAAGTTTGATGG + Intronic
1156624258 18:38889395-38889417 CAGTAGGAAGGGAAGTTGGATGG - Intergenic
1157846639 18:51009565-51009587 AAGCAGAAAAGGAAGTTGGAAGG - Intronic
1158389984 18:57036995-57037017 AAGTAAAGAGGAAAGCTGGAAGG + Intergenic
1159024077 18:63166864-63166886 AAGACAAAAGGAAAGAAGGAGGG - Intronic
1159272507 18:66170500-66170522 AAGTCGAAAGGACATGTGGTGGG + Intergenic
1159480433 18:68983966-68983988 AATTCCAAAAGAAATTTGGAAGG + Intronic
1159615637 18:70576247-70576269 AAGGCCAAAGGAAAGTTTCAGGG - Intergenic
1159871912 18:73767962-73767984 AAGGCAAAATGAAAGTGGGAGGG + Intergenic
1163457584 19:17417086-17417108 AAGTTGAAAGGAAAGTTTGACGG - Intronic
1163804883 19:19389669-19389691 CAGGGGAAGGGAAAGTTGGAGGG + Intronic
1163908696 19:20169560-20169582 AAGGTGAAAGGAAACTGGGAGGG + Intronic
1163933656 19:20422696-20422718 AAGATGAAAGGAAACTGGGAGGG - Intergenic
1163948531 19:20563160-20563182 AAGATGAAAGGAAACTTAGAGGG - Intronic
1163957709 19:20659806-20659828 AAGATGAAAGGAAACTGGGAGGG - Intronic
1163983862 19:20926747-20926769 AAGATGAAAGGAAACTGGGAGGG + Intronic
1164505591 19:28858462-28858484 AAATTGAAAGGAAAGAGGGAGGG + Intergenic
1166084065 19:40463611-40463633 AAGATGAAAGGAAAGAAGGAAGG - Intronic
1168249675 19:55134676-55134698 AAGGAGAAAGGAAAGTGGGGAGG + Intronic
1202682325 1_KI270712v1_random:18441-18463 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
925299411 2:2800046-2800068 AAGTTGGAAGGAAAGTAGGGAGG + Intergenic
925692035 2:6535335-6535357 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
925791049 2:7488654-7488676 AAGTAGAAAGGAAGGGAGGAAGG + Intergenic
927582630 2:24267510-24267532 AGGTAGAAAGGAAAGTAGGAAGG - Intronic
927789464 2:25999138-25999160 AAGAAGAAAGGAAAGAGGGAAGG - Intergenic
930146250 2:48008015-48008037 AAGAGGAAAGGAAAGGAGGAAGG - Intergenic
930330789 2:49980443-49980465 AAATAGAAAGGAAAGTTGGTAGG + Intronic
931123192 2:59244046-59244068 AAGGGGAAAGGAAAGAAGGAAGG + Intergenic
931206975 2:60157114-60157136 AAGTAGAAAAGTAAGTTGAAAGG + Intergenic
931384040 2:61780595-61780617 TAATCAAAAGGAAACTTGGATGG + Intergenic
931921735 2:67024271-67024293 AAGAGGAAAAGAAAGATGGATGG - Intergenic
931972380 2:67603147-67603169 AAGTAGGAAGGAAGTTTGGAAGG + Intergenic
932437288 2:71710004-71710026 AAGTCAAAGGGGAAGATGGAGGG - Intergenic
932541689 2:72662043-72662065 AAGAAGAAAGGAAAGAAGGAAGG + Intronic
933315809 2:80713646-80713668 AAGTGATAAGAAAAGTTGGAGGG + Intergenic
933558805 2:83866080-83866102 AAGTAGTAAGGAAAGTAGAATGG + Intergenic
934053643 2:88233031-88233053 AAGTGGAAGAGAAAATTGGAAGG + Intergenic
934587978 2:95521693-95521715 AAGCCAAAAGAAAAGTAGGAGGG + Intergenic
935582685 2:104771764-104771786 AAGTTGAAAGGAAAGTTTGATGG + Intergenic
937123702 2:119459344-119459366 AAGTAGAAAAAAAGGTTGGAAGG + Intronic
938903654 2:135819281-135819303 AAGAGGAAAGGAGAGTGGGAGGG - Intronic
939765771 2:146247755-146247777 AAATTGAAAGCAAAGCTGGAAGG + Intergenic
940388360 2:153101386-153101408 AAGTAGAAAGGAAACTTTCAAGG + Intergenic
941191751 2:162392946-162392968 ATGTGGGAAGGCAAGTTGGAAGG + Intronic
942824725 2:180161677-180161699 AATTCAAAAGGAAGGTGGGAGGG - Intergenic
943676082 2:190717616-190717638 AAGTAGAAAAGAGAATTGGAAGG + Intergenic
944923364 2:204438112-204438134 AAGTCAAGAGGGAAGTTGAAAGG + Intergenic
945686491 2:212977179-212977201 GAAAGGAAAGGAAAGTTGGAGGG - Intergenic
946480008 2:220046048-220046070 AAGTCCAAAAGAAAGATGGTGGG + Intergenic
1169055268 20:2615657-2615679 AAGGAGAAAGAAGAGTTGGAAGG + Intronic
1169451340 20:5714311-5714333 AGGTCAAAAGGAAGGTTGCAGGG - Intergenic
1169560079 20:6790395-6790417 AAGTCTCAAGGGAAGTGGGAAGG + Intergenic
1169626865 20:7580917-7580939 AAGTCGAATGGAAAGGTGGTGGG + Intergenic
1170611010 20:17913359-17913381 AAATTGGAAGGAAATTTGGACGG + Intergenic
1171297641 20:24032766-24032788 AGGAAGAAAGGAAAGGTGGAAGG - Intergenic
1172422999 20:34833660-34833682 AAGTCGAAAGGAAAGTTGGACGG - Intergenic
1172584867 20:36076097-36076119 AAGGCAAAAGGAAAGTTTGATGG - Intergenic
1175527858 20:59647910-59647932 AAGTCCTATGGAAAGTTGCAAGG - Intronic
1177885546 21:26741662-26741684 AAGAGAAAAGGAAGGTTGGATGG + Intergenic
1177936498 21:27352710-27352732 AAGTCCTAAGGAAAGATGAATGG - Intergenic
1178383260 21:32129196-32129218 AAGTCTACAGGTAAGCTGGATGG - Intergenic
1179177861 21:39021803-39021825 ATGCCGACAGGCAAGTTGGAAGG - Intergenic
1179456623 21:41505148-41505170 AGGTAGAAAGGAAAGGTGAATGG - Intronic
1182086077 22:27562138-27562160 ACGTAGAAAGAAAAGTTGGCTGG + Intergenic
1182106843 22:27695662-27695684 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1182461512 22:30486960-30486982 GAGGCCAAAGGAAAGCTGGAAGG - Intergenic
1185114458 22:48923689-48923711 GAGTAGAATGGAAAGGTGGAGGG + Intergenic
1203322959 22_KI270737v1_random:86335-86357 AAGACGGAAGGAAAGAAGGAAGG - Intergenic
949367531 3:3299332-3299354 AAATCTAAAGGGCAGTTGGAAGG - Intergenic
949898304 3:8787622-8787644 CAGTCTTAAGCAAAGTTGGAGGG - Intronic
949956843 3:9276044-9276066 AAGTCGGAAGGAAGGAAGGAAGG + Intronic
950939299 3:16877194-16877216 AAATAGGAAGAAAAGTTGGAAGG + Intronic
951767603 3:26216797-26216819 AAGTCTAAAGGAAAGTTTGGTGG + Intergenic
952441959 3:33339694-33339716 AACCCAAAATGAAAGTTGGAAGG + Intronic
953631629 3:44622938-44622960 TAGTAGAAAAGAAAGTTGGCCGG + Intronic
953698851 3:45180681-45180703 AAGCCGAGAGGAGATTTGGAGGG - Intergenic
956539475 3:70319777-70319799 CAGTGGGAAGGAAATTTGGAAGG + Intergenic
956603269 3:71046117-71046139 AACTAGAAAGGAAGGTGGGAGGG - Intronic
956823696 3:72977449-72977471 AAGTAGAAAGGAAACTAGGATGG - Intronic
957179813 3:76862053-76862075 AAGTTCAAAGGAACGGTGGAAGG + Intronic
958087236 3:88825975-88825997 AAGGAGAAAGGAAAGAAGGAAGG - Intergenic
958564708 3:95795149-95795171 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
958565735 3:95807388-95807410 AAGGCGAGAGGACAGTTGCAGGG - Intergenic
958991393 3:100849798-100849820 AAGTTGAAAGAAGAGTTGGAAGG + Intronic
959119336 3:102213478-102213500 AATTCGAGAGGAGATTTGGATGG + Intronic
960141843 3:114158843-114158865 AAGCGGAATGGAAAGTGGGAGGG + Intronic
960273345 3:115698697-115698719 AATCCCAAAGGAAAGTGGGAAGG + Intronic
961121739 3:124377591-124377613 AAGTAGACAGGAAATTTGTAAGG - Intronic
961588282 3:127953968-127953990 AAGTCAAAAGGAAAGCTGGCTGG - Intronic
962294592 3:134170972-134170994 AAGTCTAAAGGAAAATCTGATGG + Intronic
962878015 3:139550712-139550734 AAGACGGATGGACAGTTGGAAGG - Intergenic
963403830 3:144837740-144837762 AAGAAGGAAGGAAAGATGGAAGG - Intergenic
963638175 3:147825449-147825471 AAGAGGAAAGGAAAGAAGGAAGG - Intergenic
964219708 3:154329189-154329211 AAGTAGAATGAAAAGGTGGAAGG + Intergenic
964233564 3:154498598-154498620 AACTCGAAATGCAAGTTAGAAGG - Intergenic
964270901 3:154955587-154955609 TAGTCCAAAGGAAAGTTGGATGG - Intergenic
965044361 3:163556344-163556366 AAGAAGAAGAGAAAGTTGGAGGG + Intergenic
965727968 3:171739534-171739556 AAGTGGGAGGGAAAGTTGAAGGG - Intronic
965891250 3:173516515-173516537 AGGTGGAAGGAAAAGTTGGAAGG - Intronic
966266225 3:178047721-178047743 AAGGAGAAAGGAAAGGAGGAAGG + Intergenic
967230391 3:187332330-187332352 AATTCGAAATGAGATTTGGATGG + Intergenic
968026426 3:195446410-195446432 AAGCAGAAAGGAAAGTTGATGGG - Intergenic
969237310 4:5874731-5874753 AAGAGGAAAGGAAAGATGGAAGG + Intronic
970750996 4:19360924-19360946 AAGGGGAAAGGAAAATGGGAAGG - Intergenic
975285126 4:72607874-72607896 AAGTCAAAATGAGATTTGGATGG - Intergenic
976765087 4:88591386-88591408 AAGTAGAAAAGAAAGTTTCAAGG - Intronic
977694176 4:99948965-99948987 TTGGCCAAAGGAAAGTTGGAAGG - Intronic
979068992 4:116177042-116177064 AATTCGAAATGAGATTTGGATGG - Intergenic
979730590 4:124018506-124018528 AAATGGAAAGGAAAGAGGGAAGG - Intergenic
979958496 4:126986857-126986879 AACATGAAAGGAAAGTTGAAGGG + Intergenic
980019328 4:127689733-127689755 AAGGGGAAAGGAAAGGGGGAGGG + Intronic
983293763 4:165839614-165839636 AAGTGGAAAGGGGATTTGGAAGG - Intergenic
984865863 4:184280074-184280096 AACTGAAAAGGGAAGTTGGAGGG + Intergenic
987382526 5:17298926-17298948 AAGTGGAAAGAGAAATTGGAAGG + Intergenic
987539015 5:19229483-19229505 AAGGGGAAAGGAAAGTAGAAAGG - Intergenic
987911752 5:24155501-24155523 AAGTGGAAGGAAAAGTGGGAAGG + Intronic
992416073 5:76552487-76552509 AAGGAGAAAGGAAAGTGGCAAGG + Intronic
993169296 5:84396774-84396796 AAGTAGAAAAGAAAGGTAGATGG + Intergenic
993235620 5:85305558-85305580 AAGTTTGAAGAAAAGTTGGAAGG - Intergenic
993526652 5:88973639-88973661 AAGAGAAAAGGAAAGATGGAGGG + Intergenic
994319564 5:98377102-98377124 AAGCTGAAAGGAAATTTAGATGG - Intergenic
994346032 5:98687410-98687432 AACTCGAAAGGAAGGAAGGAAGG + Intergenic
994800588 5:104369195-104369217 AAATAGAAAGGAAAGAAGGAAGG - Intergenic
995466315 5:112452792-112452814 AGGTCTAAAGGAAAGTTTGATGG - Intergenic
995702967 5:114956159-114956181 AAGTCTAGAGAAAAGTTGGGGGG - Intergenic
995970865 5:117969157-117969179 AAGAAGAAAGGAAAGTTTCAAGG + Intergenic
996439046 5:123468874-123468896 AAGCATAAAGGAAAGTTTGATGG - Intergenic
997492972 5:134294660-134294682 AAGAAGAAAGGAAGGTAGGAAGG + Intronic
998382545 5:141735966-141735988 AGGAGGAAAGGGAAGTTGGAGGG - Intergenic
998634062 5:143932563-143932585 AAAGGGAAAGGAAAGTAGGAAGG + Intergenic
1000220283 5:159208683-159208705 AAGACGAAGGGAAAGAGGGAGGG + Intronic
1000431206 5:161154681-161154703 GAGATGAAAGGATAGTTGGATGG - Intergenic
1000772616 5:165375321-165375343 AAGGCGAGAAGAAAGTAGGAAGG + Intergenic
1000963171 5:167624563-167624585 AAGTTGAAAAGAAAGTTAGGTGG + Intronic
1001415228 5:171540948-171540970 AAGGAGAAAGGAAAGAAGGAAGG + Intergenic
1001838063 5:174848824-174848846 AAGAAGGAAGGAAAGATGGAAGG + Intergenic
1002508115 5:179694662-179694684 AAGTCGAAAGGGAAGTTTGATGG + Intronic
1002857092 6:1047645-1047667 AAGTCGAAAAGAAATTGGAATGG - Intergenic
1003817245 6:9855450-9855472 AAGTGGAAACTAAAGTTTGACGG - Intronic
1005010358 6:21330041-21330063 AAGACTACAGGGAAGTTGGAGGG + Intergenic
1005555624 6:26979366-26979388 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1005566240 6:27097431-27097453 GAGTTGAAAGGGAAGTTGGCTGG - Intergenic
1006479687 6:34281940-34281962 AAGTAAAAAGGAGACTTGGAGGG - Exonic
1006749469 6:36367470-36367492 AAGGCGAAAGGAAGGAAGGAAGG + Intronic
1008093118 6:47312216-47312238 AAGTCCAAAGGTAGGATGGAGGG - Intergenic
1008126248 6:47672683-47672705 AAGTAGGGAGGAAAGATGGAGGG - Intronic
1009780393 6:68261263-68261285 AAGTGGTTGGGAAAGTTGGAGGG - Intergenic
1009924719 6:70105926-70105948 TAGTCTTTAGGAAAGTTGGAGGG + Intronic
1010379342 6:75207429-75207451 CAGTCGAAAGGCAAGTTTGGAGG - Intergenic
1010704311 6:79089695-79089717 AAGAAGGAAGGAAAGATGGAGGG - Intergenic
1011230202 6:85152513-85152535 AATTCCAAAGGAAAATTTGAAGG - Intergenic
1011673452 6:89707646-89707668 AAGGTGAAAGGAAAGATCGATGG + Intronic
1013396053 6:109741080-109741102 AATTCGAAATGAGAGTTGGCTGG + Intronic
1013780014 6:113718751-113718773 AACTCCAAAGGAAAGATAGATGG - Intergenic
1014474725 6:121858274-121858296 AAGTCTAAAGGAAAGTTTGATGG - Intergenic
1014537115 6:122627539-122627561 AATTGGCAAGAAAAGTTGGAAGG - Intronic
1014998100 6:128177988-128178010 GAGTAGAAAGGAAAGAGGGAAGG + Intronic
1015137222 6:129886719-129886741 AAGAAGGAAGGAAAGATGGAAGG + Intergenic
1015208135 6:130665407-130665429 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1015367610 6:132414643-132414665 AAGGCAAAGGGAAAGTGGGATGG + Intergenic
1016132016 6:140485697-140485719 AAGTGGAGAGGGAAGGTGGAAGG - Intergenic
1016504269 6:144760897-144760919 AAGTTGAAAGGAGACTAGGAAGG + Intronic
1016793826 6:148096160-148096182 AAATCCAAGGGAAAGCTGGATGG + Intergenic
1017462420 6:154663948-154663970 CATTTTAAAGGAAAGTTGGATGG + Intergenic
1019036679 6:169066303-169066325 AAGTGGAAACGAATTTTGGAGGG - Intergenic
1019919986 7:4157343-4157365 AAGAAGGAAGGAAAGTGGGAAGG + Intronic
1020393570 7:7687035-7687057 AAGTTCAAAGGAAAGTTCAAAGG - Intronic
1022033674 7:26514880-26514902 AAGTCGCTAGGTAAGGTGGATGG + Intergenic
1022069415 7:26897652-26897674 TAGTCGAGAGGAAAGGAGGATGG - Intronic
1022077119 7:26982865-26982887 AAGTCGAAAGGAAAGTTTGATGG - Intronic
1023124896 7:36945818-36945840 CAGTTGAAAAGAAAATTGGATGG - Intronic
1023218647 7:37894839-37894861 AGGGAGAAAGGAAAGTAGGAAGG - Intronic
1023498923 7:40827736-40827758 AAGACCAAAGGAGAGCTGGATGG - Intronic
1023559401 7:41458149-41458171 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1023998383 7:45175752-45175774 AAGGCCAAAGGAAGGCTGGAGGG - Intronic
1024145783 7:46515160-46515182 GAGTAGAAAGAAAATTTGGAGGG + Intergenic
1024337622 7:48225237-48225259 AAGGAGAGAGGAAAGATGGAAGG - Intronic
1025488151 7:61077504-61077526 AAGAAGAAAGGAAAGAAGGAAGG - Intergenic
1026178212 7:68016319-68016341 AGGACGAAAGGAAAGATGGAGGG - Intergenic
1026178223 7:68016366-68016388 AAGGAGAAAGGAAGGATGGATGG - Intergenic
1026178243 7:68016444-68016466 AAGAGGAAAGGAAGGATGGAGGG - Intergenic
1026595734 7:71732973-71732995 AAGGAGAGAGGAAAGTAGGAAGG + Intergenic
1026890860 7:73981429-73981451 AAGAAGGAAGGAAAGATGGAAGG + Intergenic
1027403603 7:77834974-77834996 TAGTCCAAAGGAAAGCTGGCCGG + Intronic
1028436885 7:90814288-90814310 CAGTCGGAAGGAAAGTTTCAGGG + Intronic
1028797328 7:94918390-94918412 AAGGTAAAAGGAAAGTTAGAAGG + Intronic
1030414310 7:109221508-109221530 AACTTGACAGGAATGTTGGAAGG - Intergenic
1031405683 7:121383868-121383890 AATTCAAAAGGAAATTTTGATGG + Intronic
1031651931 7:124302316-124302338 AATTCGAGATGAAATTTGGATGG - Intergenic
1031986701 7:128168228-128168250 AGGTCGGAAGCAAAGCTGGAGGG + Intergenic
1032739281 7:134722767-134722789 TAGCAGAAAGGAAAGGTGGAGGG - Intergenic
1033384732 7:140861843-140861865 AAGTAGAAAGGAAAAGTGGGAGG + Intronic
1033970424 7:147032675-147032697 AAGAAGAAAAGAAAGATGGAAGG + Intronic
1034643543 7:152624205-152624227 AATTCGACAGGAGATTTGGATGG + Intergenic
1034735276 7:153423467-153423489 AAGTGTGAAGGATAGTTGGAAGG - Intergenic
1035090740 7:156307952-156307974 AAGTCCAAAAGAAAGCAGGAAGG - Intergenic
1035969191 8:4228341-4228363 AACTGGAAAGGAAAATGGGAGGG - Intronic
1036508453 8:9378399-9378421 AAGTAGAAAGAAAAGAAGGAAGG + Intergenic
1037443618 8:18942731-18942753 AATTCGAGATCAAAGTTGGAAGG - Intronic
1038047069 8:23774402-23774424 AATTAGAAAGAAAAGTTGGCAGG - Intergenic
1038540625 8:28386791-28386813 GAGTCCAAAGGAAAATGGGAAGG - Intronic
1038654033 8:29432168-29432190 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1041628192 8:60055087-60055109 AAGAAGGAAGGAAAGTGGGAGGG + Intergenic
1042781500 8:72495839-72495861 AAGAGGAAAGAAAGGTTGGATGG + Intergenic
1043521067 8:81045976-81045998 AAGACAAAAGGAAAGTTGTGAGG - Intronic
1044205606 8:89489407-89489429 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1044510209 8:93067710-93067732 AATTTGAAAGGAATGGTGGAGGG + Intergenic
1045803265 8:106126573-106126595 AAGTAGAAACAAAATTTGGAGGG + Intergenic
1046094403 8:109540051-109540073 AGGGCGAAAGGAAGGTGGGAGGG - Intronic
1046359198 8:113128295-113128317 AGGTAGAAAGGAAGGTAGGAAGG + Intronic
1047240130 8:123079775-123079797 AAGGAGAAAGGAAAGCTTGAAGG - Intronic
1047579347 8:126195707-126195729 AAGGAGAAAGGAAGGTAGGAAGG + Intergenic
1049793401 8:144483925-144483947 AAGTTGGAAGGAAAGATGGTAGG - Intronic
1050389132 9:5119346-5119368 AATTAGAAAGGAACCTTGGAAGG - Intronic
1051006562 9:12352569-12352591 AAGTGGGAAGTAAAGTGGGAGGG - Intergenic
1051813479 9:21076849-21076871 AAGAGAAAAGGAAAGCTGGAGGG - Intergenic
1052517296 9:29499393-29499415 AAGTCGAAAGGTATATTGGGAGG - Intergenic
1053157075 9:35788962-35788984 AAGACAAAAGGGAAGTGGGAAGG - Intergenic
1053219883 9:36303624-36303646 AAGTTGAAAGGAAAGTTTTATGG - Intronic
1055235576 9:74118786-74118808 TAGAGGAAAGGAAAGTAGGAAGG + Intergenic
1057466822 9:95321750-95321772 AAGTAGCAAAGAAAGTTGGCTGG + Intergenic
1058935811 9:109768152-109768174 AAGGAGGAAGGAAAGTAGGAGGG + Intronic
1059730233 9:117049974-117049996 AAGGAGAAAGGAAAGGTGGTGGG + Intronic
1060257561 9:122046129-122046151 AAGTCGACATGAAACTTGGGCGG - Intronic
1061244726 9:129395598-129395620 AGGATGAAAGGAAAGATGGATGG + Intergenic
1062143372 9:134972779-134972801 AAGAAGAAAGGAAAGAAGGAAGG + Intergenic
1185887106 X:3792673-3792695 AAAAAGAAAGAAAAGTTGGAGGG + Intergenic
1186433660 X:9525262-9525284 AAGTCTAATGGGAATTTGGAAGG - Intronic
1187116356 X:16356079-16356101 CAGGCTAAATGAAAGTTGGATGG + Intergenic
1188983058 X:36744875-36744897 AGGTGGAAAGGAAAGTGGTATGG + Intergenic
1189344564 X:40231161-40231183 AAGTCCAAATGAAAGTTTTAGGG - Intergenic
1189554525 X:42128186-42128208 AAGGCAAAAAGAAAGTTGAAAGG + Intergenic
1189700983 X:43716168-43716190 AAGTAAACAGGAAAGGTGGATGG + Intronic
1190748139 X:53338816-53338838 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1190798815 X:53770024-53770046 AAGAGGAAAGGGAAGTGGGAGGG - Intergenic
1191920771 X:66254844-66254866 AAGTAGAAAAGAAAGGTTGAGGG + Intronic
1192272892 X:69600099-69600121 AAGTGGAAAGGCCAGTTAGAAGG + Intergenic
1192720047 X:73685516-73685538 AGGTGGAAAGGAAAGTGGTATGG + Intronic
1193185106 X:78502339-78502361 AAGTGGAAAGAAGAGTGGGAAGG + Intergenic
1193929535 X:87534944-87534966 AAGTGGAGAAGAAAGTTTGATGG + Intronic
1195370440 X:104167150-104167172 CGGTCGAAAGGAAAATAGGAGGG - Intronic
1195670763 X:107467937-107467959 AAGTCAAAAGGAAAGATAGAAGG - Intergenic
1195726278 X:107920270-107920292 AAGTTGAAAGAAAAGGTGAAGGG - Intronic
1196594055 X:117522570-117522592 AAGTCTGAAGTAAACTTGGAAGG - Intergenic
1196764040 X:119226810-119226832 AAATCGAAAGAACAGGTGGAAGG - Intergenic
1197308493 X:124873916-124873938 AAGTAGGAAGAAAAGTTGGGTGG - Intronic
1197697096 X:129562037-129562059 AACTAGGAAGGAAAGGTGGAAGG + Intronic
1197781317 X:130163323-130163345 AAGTTTAAAGGTAAGGTGGAGGG + Intronic
1198160535 X:134003501-134003523 AGGTAGAAAGGAAAGAAGGAAGG + Intergenic
1198260641 X:134961807-134961829 AAGTCGAAAGGAAAGTTTGATGG - Intergenic
1198277081 X:135105127-135105149 ATGTTGACCGGAAAGTTGGAGGG - Intergenic
1198428612 X:136543827-136543849 AAGAAGAAAGGATAGATGGAAGG + Intronic
1199607932 X:149591630-149591652 GAGAGGAAAGGAAAGTAGGAAGG + Intergenic
1199631188 X:149777726-149777748 GAGAGGAAAGGAAAGTAGGAAGG - Intergenic
1199773179 X:150987792-150987814 AAGTCGAAAGGAAAGTTTGATGG + Exonic