ID: 1172424352

View in Genome Browser
Species Human (GRCh38)
Location 20:34845219-34845241
Sequence CCCTGATCTGGGGCATCCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172424341_1172424352 19 Left 1172424341 20:34845177-34845199 CCAGTTACTCTGGGATTGGGTTT 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1172424352 20:34845219-34845241 CCCTGATCTGGGGCATCCCTGGG 0: 1
1: 0
2: 0
3: 14
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172424352 Original CRISPR CCCTGATCTGGGGCATCCCT GGG Exonic
900565831 1:3331395-3331417 TCCTGATCTGGGGGATTCCCTGG - Intronic
900648391 1:3719155-3719177 CCCTGCTCTGTGGTTTCCCTAGG + Intronic
901445626 1:9306226-9306248 CCCAGAGCTCGGCCATCCCTCGG - Intronic
901706800 1:11079710-11079732 CCTTGAGCAGGGGCATCTCTCGG + Exonic
901925708 1:12564915-12564937 CACTGAACTGGGACATCCCCAGG + Intergenic
904331628 1:29761527-29761549 CTCTGTTCTGGGGCTCCCCTGGG - Intergenic
904429231 1:30451304-30451326 CTCTGCTCTGTGGCCTCCCTGGG - Intergenic
904744252 1:32701721-32701743 CCCTGACCTCGGGCTTCCTTGGG + Intronic
905637938 1:39567913-39567935 TCCTGGTCTGGGGCCACCCTTGG - Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
906710903 1:47929348-47929370 CCCTGCTCTGTGCCATCCCCTGG + Intronic
910345114 1:86227741-86227763 TACTGAGCTGGGTCATCCCTGGG + Intergenic
915247939 1:154569296-154569318 CATTAATCTGGGGCCTCCCTGGG + Intronic
915970696 1:160353099-160353121 TCCTGTTCTGGGCCATGCCTAGG - Intronic
919825113 1:201498124-201498146 CACTGACCTGAGGCATCACTTGG - Intronic
919928475 1:202206084-202206106 TCCAGATCTGGGGCAACCCAGGG + Intronic
920707914 1:208268224-208268246 CAATGATCTGGGGCATCCTATGG + Intergenic
920899576 1:210093958-210093980 CCATGATCTGTGGCCACCCTAGG - Intronic
923211637 1:231808817-231808839 ACCTGGCCTGGGGCATCCCCTGG + Intronic
1064007919 10:11713076-11713098 CTCTTATTTGGGGCATCCCCAGG + Intergenic
1067837197 10:49648935-49648957 CCCTGTGCTGGGGCAGCCGTGGG - Intronic
1070717633 10:78734111-78734133 CCCTGCTCTGGGGAATGCATTGG + Intergenic
1072631889 10:97151988-97152010 CCCTCAATGGGGGCATCCCTGGG + Intronic
1073566030 10:104536503-104536525 GCCTGTTTTGGGCCATCCCTGGG - Intergenic
1074018744 10:109562879-109562901 CTCGGATCAGGGGCCTCCCTTGG + Intergenic
1074100145 10:110348388-110348410 TCATGCTCTGGGGCTTCCCTGGG - Intergenic
1074205788 10:111281649-111281671 CCCAGATCTGGGGCAGCCTGAGG - Intergenic
1074297400 10:112203194-112203216 CCCTTCTCTGGGGTAGCCCTAGG + Intronic
1075910355 10:126119380-126119402 CACTGACCTGGGGCCTCCCCTGG - Intronic
1076916210 10:133424119-133424141 CCCTGATCTGAGCCAGCTCTTGG - Intronic
1076936318 10:133568914-133568936 CCCTGATCTGAGCCAGCTCTTGG - Intronic
1077102106 11:827021-827043 CCCTGCTCCGGGGGGTCCCTGGG + Intronic
1083853452 11:65380631-65380653 CCCTGATGGGGGTCATGCCTGGG + Intronic
1084961638 11:72719965-72719987 GGCTGATCTGGGGCCTCCCTGGG + Intronic
1085483511 11:76842295-76842317 CCCTGATCTGGTACCTTCCTGGG + Intergenic
1087038119 11:93773975-93773997 CCCTGATGTGGGGCAGACCTTGG + Intronic
1089341996 11:117764219-117764241 CCCTGCTCTGGGGCACTGCTGGG + Intronic
1089637068 11:119821728-119821750 CTCTGCCCTGGGGCATCCCGCGG + Intergenic
1093954282 12:25198186-25198208 CCCTGGACTGGGGCATCCTCAGG + Intronic
1096912277 12:54996473-54996495 CCCAGAACTGGGTCTTCCCTAGG - Intergenic
1098185087 12:67888386-67888408 CACTGATCTGGGGTGTCCCTGGG + Intergenic
1101490077 12:105201966-105201988 TCCTGCTCTGAGGCCTCCCTGGG + Intronic
1102583597 12:113907960-113907982 CCCTGACCTAGGGCCTCTCTGGG + Intronic
1104771951 12:131369190-131369212 CCACGATCTGGGCCATCCATGGG - Intergenic
1105007938 12:132734544-132734566 TCATGAGCTGGGGTATCCCTGGG - Exonic
1105378458 13:19864589-19864611 GCCTGCCCTGGGGCGTCCCTGGG + Intergenic
1110431741 13:75432235-75432257 ACTTGATCTGGCCCATCCCTGGG + Intronic
1113162786 13:107401309-107401331 CCCTGGTTTCAGGCATCCCTAGG + Intronic
1113413154 13:110107875-110107897 CCCTGTTCTCAGGGATCCCTTGG + Intergenic
1117021121 14:51571498-51571520 CTCTGATCTGGTGTAACCCTGGG + Intronic
1117899200 14:60515334-60515356 CCCAGATCTGTGGCCTCCGTGGG - Intronic
1118387178 14:65265518-65265540 CCCTGACCTGGGGCTTTTCTGGG + Intergenic
1119534764 14:75394055-75394077 CTCTGATCTCGGGCTGCCCTAGG + Intergenic
1119572268 14:75685561-75685583 CACTGATGTGGGGCATCTGTAGG + Intronic
1121715651 14:96071913-96071935 CACAGTTCTGGGGCATGCCTGGG + Intronic
1122306127 14:100767936-100767958 ACCTGCTCTGTGCCATCCCTGGG - Intergenic
1122577825 14:102752822-102752844 CCCTGCCCTGGGTCCTCCCTGGG + Intergenic
1122768508 14:104086670-104086692 CTGTGATGTGGGGCCTCCCTTGG + Intronic
1124449200 15:29770075-29770097 CCCTGATCCTGGGTAGCCCTAGG + Intronic
1128332264 15:66763468-66763490 CCTTGAGCTGGAGCAGCCCTCGG + Intronic
1128609189 15:69060210-69060232 CACTGAGCTGGGGCATTCGTGGG + Intronic
1129263242 15:74380749-74380771 CCCTGATGTGGAGGCTCCCTGGG + Intergenic
1130209782 15:81912481-81912503 CCCTGGGCTGGGTCAGCCCTGGG - Intergenic
1134409402 16:13991601-13991623 CCCAGAACTGGGGCCTCTCTAGG - Intergenic
1136085366 16:27881023-27881045 CCCTGACCTGGGAGATCCCTCGG - Intronic
1137754230 16:50888721-50888743 CCCTGCTCTGGGGTCTCTCTGGG + Intergenic
1138454138 16:57111727-57111749 CCCAGATCTGGGGCCTTCCAAGG - Intronic
1138891702 16:61150616-61150638 CCCTGCAGTGGGGCCTCCCTTGG + Intergenic
1139518691 16:67467122-67467144 CTATGATATGGTGCATCCCTGGG + Intronic
1141149585 16:81554945-81554967 CCCTTCTGGGGGGCATCCCTAGG - Intronic
1141450275 16:84095179-84095201 CCCTGATCTGGGCAATTCCACGG - Intronic
1143273801 17:5695109-5695131 CTTTGGTCTGGGACATCCCTGGG + Intergenic
1143797447 17:9348918-9348940 CCCTGGTTTCAGGCATCCCTTGG - Intronic
1144599267 17:16598442-16598464 CCCTAAACTCGGGCATCTCTAGG - Intergenic
1145031477 17:19507836-19507858 CCAGGATCGGGGGGATCCCTGGG - Intronic
1145713117 17:26994513-26994535 CCATGCTCTGGGGCCTCCCGGGG + Intergenic
1146462078 17:33054280-33054302 CCCAGATTTGGGCCAGCCCTGGG - Intronic
1148044773 17:44736668-44736690 CCCTGAGCTGGAGCAGACCTGGG - Intronic
1148110196 17:45140022-45140044 CCCAGATGTGAGGCATCTCTGGG + Intronic
1151388146 17:73767957-73767979 CTCTGTTCTGGGGACTCCCTGGG - Intergenic
1151536723 17:74743124-74743146 CCCAGATCTGGGACACCGCTGGG + Exonic
1151816390 17:76473492-76473514 CCCTGCTCTGGGGCTACCCATGG - Intronic
1151980831 17:77507451-77507473 CCCTGTAATGGGTCATCCCTTGG - Intergenic
1152529912 17:80911922-80911944 CTCTGGTCTGGGGCCTCCGTGGG - Intronic
1152812063 17:82386809-82386831 CCCTGCTCTGGGCCCTCCCTGGG - Intergenic
1161482549 19:4518164-4518186 CCCGGCTCTGGGGCATCTCCAGG + Intergenic
1162283870 19:9723210-9723232 CCATGATCTGCAGGATCCCTGGG + Intergenic
1164768271 19:30788399-30788421 CCCTGCAATGGGCCATCCCTTGG + Intergenic
1165092253 19:33393358-33393380 CCTGTATCTGGGGCAGCCCTGGG + Intronic
1167074376 19:47239891-47239913 CCCGGATCTGGGGGAGCCCTCGG + Intergenic
1167449051 19:49556451-49556473 CTCTGATCAGGGGCCTTCCTGGG + Intronic
1167686146 19:50957990-50958012 CTGTGAGCTGGGGCAGCCCTAGG - Intergenic
1167791551 19:51686300-51686322 CCCTGCTCTGAGCCATGCCTGGG + Intergenic
1168497988 19:56870085-56870107 CCCTGATGGGCGGCAGCCCTGGG - Intergenic
927841120 2:26444827-26444849 CCATCATCTGGGGCTTCCCTGGG + Exonic
934164175 2:89279344-89279366 CTCTGGTCTGGGGTTTCCCTGGG + Intergenic
934203099 2:89903183-89903205 CTCTGGTCTGGGGTTTCCCTGGG - Intergenic
935287806 2:101580714-101580736 CCCTGCTCTAGGACATGCCTAGG + Intergenic
945041975 2:205749917-205749939 CTCTGATCTGGGGGACCACTAGG - Intronic
948831265 2:240599313-240599335 CCCTGGCCTGGGGCATGCCCTGG - Intronic
948987329 2:241533412-241533434 CCCAGGTCTGGAGCAGCCCTGGG - Intergenic
1169391993 20:5198094-5198116 CTCTTTTCTGGGCCATCCCTTGG + Intergenic
1169392827 20:5204201-5204223 CCCTGTGCTGGAGCATCCCCAGG + Intergenic
1170513988 20:17108858-17108880 CCCTGATCTGGGCAAGCTCTGGG + Intergenic
1171372791 20:24672567-24672589 CCCTGATGTGTGGCTTCCCCCGG + Intergenic
1172424352 20:34845219-34845241 CCCTGATCTGGGGCATCCCTGGG + Exonic
1175143828 20:56881130-56881152 CCCTGGTTTGGGGCCTCCCTGGG - Intergenic
1175143845 20:56881167-56881189 CCCTGGTTTTGGGCCTCCCTTGG - Intergenic
1175953091 20:62593820-62593842 CCCCAACCTGGGGCATCCTTTGG + Intergenic
1175965427 20:62657935-62657957 CACTGCCCTGGGGCAGCCCTGGG + Intronic
1176046820 20:63097148-63097170 TCCTGACCTTGGGCTTCCCTGGG - Intergenic
1176119132 20:63446204-63446226 CTCTGTTCTGGGGCTTCCCAAGG - Intronic
1176218966 20:63961090-63961112 CCCTGAGCTGGAGCTGCCCTCGG - Intronic
1177168948 21:17634259-17634281 CCTTCATCTGGGGCCTACCTTGG + Intergenic
1178317494 21:31578772-31578794 TCCTCCTCTGGGGCATCCATAGG + Intergenic
1179034283 21:37746313-37746335 CCCAGATCTGGATTATCCCTGGG - Intronic
1179632496 21:42687277-42687299 CCATGGTCTGGGGCATCTTTGGG + Intronic
1179799157 21:43802857-43802879 CCCTCACCAGGGGCAACCCTGGG + Intronic
1179991248 21:44949270-44949292 CCCTGATCAGGAGCAGCCCCCGG - Intronic
1180701173 22:17782145-17782167 CCCTGGGCTGGGCCAGCCCTGGG - Intergenic
1180952922 22:19728852-19728874 TCCTCATCTGGGGCCTCTCTGGG - Intergenic
1182069860 22:27455969-27455991 CCCTTATCTACGGCATCTCTGGG - Intergenic
1182298926 22:29327331-29327353 CCCTGATCAGGGGCAGCCGTGGG - Intergenic
1182524584 22:30907268-30907290 CACTGAGATGGGGCACCCCTAGG - Exonic
1184321416 22:43744743-43744765 CCCTTATCTGGGTCCTCTCTGGG - Intronic
1184711101 22:46250033-46250055 CCCTGACCTCGGGCAGCGCTGGG - Intronic
1184755176 22:46511794-46511816 CCCTGGTATGGGGCAGCCCCAGG + Intronic
1184933021 22:47695476-47695498 CCCTGGTCTGGGGAATTACTGGG + Intergenic
1185018031 22:48357058-48357080 CCCTGAGCAGGGGCATCTGTGGG - Intergenic
1185134107 22:49058962-49058984 CCCAGACCTGGGGCCTCCCAGGG + Intergenic
1185230177 22:49675735-49675757 CCCTGAGTTGGTGCAACCCTTGG + Intergenic
951522984 3:23626552-23626574 CACAGATCTGAGGCAGCCCTAGG + Intergenic
952510017 3:34043514-34043536 ACCTGATTTGGGGCATTGCTAGG + Intergenic
953250248 3:41239255-41239277 GCCAGATCTGGGGCATGCCCAGG + Exonic
954369401 3:50162337-50162359 CCCTAATCTGAGGGAACCCTGGG - Intronic
954680642 3:52344210-52344232 CACTGCTCTGGGGCCTGCCTTGG + Intronic
955973621 3:64460464-64460486 CCCTGAGATGGGGCATTCCAGGG + Intergenic
956928609 3:74017048-74017070 CCCTGATCTGGGAGATTCTTTGG + Intergenic
959824988 3:110783424-110783446 CCCTGATATTGCCCATCCCTTGG - Intergenic
962508760 3:136077129-136077151 CCCTGTCCTGGGGCCTCCCATGG + Intronic
962954706 3:140253669-140253691 CCCTTCTCTGGGACATACCTGGG + Intronic
962981062 3:140490415-140490437 CCCAGATCAGGGGCATCCCACGG + Intronic
964495451 3:157284979-157285001 CCCTTTTCTGAGGCCTCCCTTGG + Intronic
964828332 3:160854635-160854657 CCCTGATCTGCCGTATTCCTAGG - Intronic
965770696 3:172178645-172178667 CACTCAGCCGGGGCATCCCTGGG + Intronic
966515906 3:180820861-180820883 ACATGATCTGGGTCATCCCACGG - Intronic
967045838 3:185736081-185736103 CGGTGATCTGGGGGACCCCTTGG - Intronic
967473609 3:189890672-189890694 CTCTGATGTGGGGCATCCAAGGG + Intronic
971316389 4:25571689-25571711 CCCTCTTCTGGGGGACCCCTGGG + Intergenic
972348209 4:38211503-38211525 AGCTGATCTGGGGCTTTCCTAGG + Intergenic
972632588 4:40855197-40855219 CTCTGCACTGGAGCATCCCTGGG - Intronic
976894670 4:90094974-90094996 TCCTGATCTGTGTCATCTCTGGG + Intergenic
978333532 4:107641714-107641736 CCCTGATTTGGGATATCCTTTGG - Intronic
992476295 5:77104617-77104639 CCCTGATCTTGGACTTCCCAGGG + Intergenic
994110330 5:95995817-95995839 CCCAGATCTGGGTCATGCATTGG - Intergenic
995436676 5:112144124-112144146 CCCTGATATGGAGCAGCCCTGGG + Intronic
997471433 5:134119590-134119612 CCCTGGCTTGGGGCATCCCCAGG - Intronic
998406156 5:141875966-141875988 ACCTGCTCTGGGTCAACCCTCGG - Intronic
1002024493 5:176387851-176387873 CCTTGGTCTGAGGCTTCCCTAGG - Intronic
1007822456 6:44570683-44570705 CCCTGGTCTGAGACATCCCTGGG + Intergenic
1010795786 6:80114949-80114971 CCCTGAGATGGGGCAACCCAGGG + Intronic
1014384801 6:120786704-120786726 CCCTGGCTTGGGGAATCCCTAGG - Intergenic
1017968031 6:159283936-159283958 AACTGACCTGGGGCAGCCCTTGG - Intergenic
1018968655 6:168509121-168509143 CCCAGATCGGAGGCTTCCCTGGG + Intronic
1019210472 6:170400863-170400885 CCATGCTCTGGGGGAGCCCTGGG - Intronic
1019423613 7:963062-963084 CCCTGATCTGGGCCACATCTGGG + Intronic
1019690822 7:2410677-2410699 CCCTCAGCTGGGGAATCCCAGGG - Intronic
1020429451 7:8104494-8104516 CCCTGAACTGTGGCACCCCAAGG - Intergenic
1021393354 7:20121182-20121204 CTCGGATCGGGGGCCTCCCTTGG + Intergenic
1022522894 7:31019369-31019391 ACATCATCTGGGGCATCCCAAGG + Intergenic
1025032266 7:55567605-55567627 CCCAGACCTGGGGCTTTCCTTGG - Intronic
1025281634 7:57629843-57629865 CCCTGGTCTGGAGCCTTCCTGGG + Intergenic
1025303096 7:57835672-57835694 CCCTGGTCTGGAGCCTTCCTGGG - Intergenic
1026848081 7:73708746-73708768 CCCTACTCTGGGCCATCTCTGGG - Intronic
1027046404 7:74994172-74994194 CCCAGATCAGGGGCCACCCTGGG + Intronic
1029483067 7:100824493-100824515 CCTAGATCTGGGGTATCCCAAGG - Intronic
1030013829 7:105198421-105198443 CCCTGATCTTGGTAATCCCCAGG + Intronic
1030363710 7:108623118-108623140 CCATTATCTGGGACATTCCTGGG - Intergenic
1032505957 7:132434946-132434968 CTCTGCTCTGGGGCCACCCTGGG + Intronic
1033637194 7:143222962-143222984 AACTGATCTTGGGCAACCCTGGG + Exonic
1034746654 7:153529281-153529303 CCGGGATCAGGGGCAGCCCTGGG + Intergenic
1035732387 8:1862206-1862228 CCTTGCTCTGGAGCCTCCCTGGG + Intronic
1036572966 8:9997972-9997994 CCCTGATCTCTGACATCCGTGGG + Intergenic
1037751113 8:21683032-21683054 TCCTGTTCAGGGGGATCCCTGGG + Intergenic
1037931181 8:22881187-22881209 CCAGAAACTGGGGCATCCCTGGG - Intronic
1038055146 8:23851058-23851080 GCCTCATCTGCAGCATCCCTGGG - Intronic
1044908294 8:97029091-97029113 CACTGATCTTGGCCATCCATTGG + Intronic
1047513862 8:125536709-125536731 CTCTGATCTGTGAAATCCCTAGG + Intergenic
1049143741 8:140981840-140981862 CCCTGACCTAGGGCATAACTAGG + Intronic
1049449792 8:142654519-142654541 GCCTGTTCTGGGGTAGCCCTGGG - Intergenic
1049812489 8:144581754-144581776 TGCTGATCTGGGGGATCCTTGGG - Intronic
1052609029 9:30745006-30745028 CCTTGATCTGGGCAATCCCTGGG + Intergenic
1052815542 9:33100154-33100176 CCATGCCCTGGGGGATCCCTCGG + Intergenic
1053210513 9:36223646-36223668 GCCTGGTCTGGGCCAGCCCTGGG + Intronic
1056666826 9:88587976-88587998 ACCTGGTCTGGAGCGTCCCTGGG + Intergenic
1056711877 9:88998083-88998105 CCCTGATCAGGGGCCTCTCAGGG - Exonic
1057624854 9:96667977-96667999 CCCTGCTCTGGTGCACCCCCAGG + Intergenic
1060819466 9:126652925-126652947 CCCTGATCTGGCCCGTGCCTTGG - Intronic
1061587039 9:131576064-131576086 CCCTGATCCCCGCCATCCCTGGG + Intergenic
1061865307 9:133489071-133489093 CCCTGCTCTGGGGCAGACATGGG - Intergenic
1062052637 9:134455554-134455576 CTCTGACCTAGGCCATCCCTGGG - Intergenic
1062559763 9:137136310-137136332 CCCTGACCTGGGGGAGCCCAGGG - Intergenic
1062708169 9:137956708-137956730 CTCTGTCCTGGGGCATTCCTGGG + Intronic
1190746034 X:53321907-53321929 CCCTCATCCCAGGCATCCCTTGG + Intergenic
1192229609 X:69255981-69256003 CTGTGCTCTGGGGCCTCCCTTGG + Intergenic
1193211372 X:78810701-78810723 CCCTGACCTGGGGAACCCCTAGG + Intergenic
1197262268 X:124332192-124332214 CCATGATCTGGATCTTCCCTAGG - Intronic
1199627076 X:149750630-149750652 CCCCAACCTGGGGCTTCCCTGGG - Intergenic
1201692124 Y:16778899-16778921 CCCTGATCTTAGGGTTCCCTGGG - Intergenic
1202029926 Y:20560802-20560824 CCCTGCTCTGGAGGATCTCTGGG + Intergenic