ID: 1172435902

View in Genome Browser
Species Human (GRCh38)
Location 20:34928759-34928781
Sequence CCCCTCAGGAGGGCTAGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172435889_1172435902 24 Left 1172435889 20:34928712-34928734 CCAGTATTTACCCTTCCATAAAA 0: 1
1: 0
2: 1
3: 19
4: 278
Right 1172435902 20:34928759-34928781 CCCCTCAGGAGGGCTAGGAGAGG 0: 1
1: 0
2: 2
3: 18
4: 209
1172435893_1172435902 13 Left 1172435893 20:34928723-34928745 CCTTCCATAAAAACTTTGGAGGT 0: 1
1: 0
2: 0
3: 11
4: 139
Right 1172435902 20:34928759-34928781 CCCCTCAGGAGGGCTAGGAGAGG 0: 1
1: 0
2: 2
3: 18
4: 209
1172435894_1172435902 9 Left 1172435894 20:34928727-34928749 CCATAAAAACTTTGGAGGTCTTT 0: 1
1: 0
2: 8
3: 18
4: 220
Right 1172435902 20:34928759-34928781 CCCCTCAGGAGGGCTAGGAGAGG 0: 1
1: 0
2: 2
3: 18
4: 209
1172435891_1172435902 14 Left 1172435891 20:34928722-34928744 CCCTTCCATAAAAACTTTGGAGG 0: 1
1: 0
2: 1
3: 23
4: 271
Right 1172435902 20:34928759-34928781 CCCCTCAGGAGGGCTAGGAGAGG 0: 1
1: 0
2: 2
3: 18
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172435902 Original CRISPR CCCCTCAGGAGGGCTAGGAG AGG Exonic
900466180 1:2826600-2826622 CCCCTCAGGAGGGCCAGGCCTGG - Intergenic
900574009 1:3374103-3374125 CCTCTCAGGAGGGCCAGGGCTGG + Intronic
903258135 1:22116367-22116389 CTACTCAGGAGGGTGAGGAGTGG - Intergenic
904058108 1:27685712-27685734 CTCATCAGGAGGACTCGGAGAGG - Intergenic
904362954 1:29990376-29990398 CCCCTCAGGCAGCCTAGCAGAGG + Intergenic
904811247 1:33164710-33164732 CACCTCTGGAGGGCTTCGAGGGG + Intronic
907118369 1:51989444-51989466 CCACTCAGGAGTCCAAGGAGGGG - Intronic
915594269 1:156887478-156887500 CCCCTCTGCTGGGCTGGGAGAGG + Intergenic
915839223 1:159201799-159201821 CCCCTCAGGGGGGGAAGCAGAGG - Exonic
920505621 1:206513420-206513442 TCCCTCAGAAGGGCTGGGGGTGG - Intronic
922818812 1:228470403-228470425 GCCCTACGGTGGGCTAGGAGGGG + Intergenic
923154848 1:231269249-231269271 CCCTTCAGGAAGACCAGGAGAGG + Intronic
923900318 1:238319451-238319473 CACCTCAGGTGGGTTAGGTGAGG - Intergenic
924055796 1:240122805-240122827 CCACTCAGGAGGCTTAGGTGGGG + Intronic
1063004135 10:1952484-1952506 CCCCTGAAGAGGCCTCGGAGTGG - Intergenic
1064031710 10:11887056-11887078 CCCCGCAGGAGGGGTCTGAGGGG + Intergenic
1064402984 10:15036598-15036620 CTACTCAGGAGGCCAAGGAGGGG - Intronic
1065240029 10:23695389-23695411 CCCCCCAGGAGGGCCAGGCCGGG + Intronic
1066055662 10:31678100-31678122 TCACTGAGGAGGGCTTGGAGCGG - Intergenic
1067246792 10:44554113-44554135 CCCCTCAGGTGTGCATGGAGCGG - Intergenic
1067782828 10:49221427-49221449 CCGCTCTGGAGGGCTAGCAAAGG - Intergenic
1072256016 10:93621055-93621077 ACCCCCAGGAGGAATAGGAGGGG - Intronic
1073112660 10:101071933-101071955 TCCCTGAGGAGGGTTAGGGGTGG - Intergenic
1073326714 10:102647523-102647545 CCTCCCAGGAGGGAGAGGAGGGG + Intronic
1074188377 10:111115741-111115763 CCCCTGAGGTGGCCTGGGAGGGG - Intergenic
1074437090 10:113443481-113443503 CCCAATAGGAGAGCTAGGAGGGG - Intergenic
1074814736 10:117135411-117135433 CCCCTCTGCAGGCCTAGCAGTGG + Intronic
1074897606 10:117790898-117790920 CCTCTCAGAAGAGCTGGGAGAGG + Intergenic
1077206460 11:1346885-1346907 CCCCTGAGGTGGGTGAGGAGGGG + Intergenic
1078924299 11:15860132-15860154 CCCCTCAGGAGAGTACGGAGTGG + Intergenic
1081992062 11:47343230-47343252 CCCCTCTGGATGGCTTGGGGTGG - Intronic
1083674130 11:64316118-64316140 CCCCCTAGGAGGGGGAGGAGAGG - Exonic
1084106739 11:66985370-66985392 CCAGTCAGGAGAGCCAGGAGGGG + Intergenic
1084266325 11:68007182-68007204 TTCCTCAGGAGGGCAAGGAGAGG + Intergenic
1087293276 11:96341847-96341869 CCCCGCAGGAGGGCTAGGGGGGG - Exonic
1087891959 11:103545542-103545564 CTACTCAGGAGGCCAAGGAGGGG + Intergenic
1089138702 11:116269751-116269773 CCTCTCAGGTGGGGTTGGAGAGG - Intergenic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1091045045 11:132317885-132317907 TCCCCCAGGAGGGCTGGGAAGGG + Intronic
1091141911 11:133242567-133242589 GCCCTTATGAGGGCAAGGAGAGG - Intronic
1091412526 12:253576-253598 CCTCTCAGAAGGGCCTGGAGGGG - Intronic
1092879029 12:12873488-12873510 GCCCTCAGAAGGGCCAGGTGCGG - Intergenic
1097178307 12:57156357-57156379 CCCCACAGGAGGGCCCAGAGAGG - Intronic
1097182797 12:57180606-57180628 CCCTTCAGGAGAGCTGGGTGTGG + Intronic
1097232747 12:57522495-57522517 TCCCTGAGGAGGGCTGGGATTGG + Intronic
1102986178 12:117280502-117280524 CCCATCAGGAGGGCTGAGTGAGG + Intronic
1103363512 12:120367769-120367791 CCCCTCACCAGGACTAGGGGAGG + Intronic
1104211376 12:126691932-126691954 CACTTCAGGAAGGCTATGAGCGG - Intergenic
1104214827 12:126725432-126725454 ACCCTCAACAGGACTAGGAGAGG - Intergenic
1109619387 13:64881190-64881212 TCTGTCAGGAGGACTAGGAGAGG + Intergenic
1110295815 13:73863815-73863837 CCCGCCAGGAGGGCTTGGGGTGG + Intronic
1113914617 13:113863197-113863219 CCTCTCAGGAGGACGAGGCGCGG + Intronic
1114266563 14:21075684-21075706 CTCCTCAGGAGGGCACGGTGGGG - Exonic
1118335052 14:64846280-64846302 AACATCAGGAGGGGTAGGAGGGG + Intronic
1118987656 14:70770574-70770596 TCCATCAGCAGGGCAAGGAGGGG + Intronic
1119242514 14:73073025-73073047 CTCCTCAGGAGGGCTGAGATGGG - Intronic
1119521994 14:75293600-75293622 GCCCTCAGAAGGGACAGGAGAGG + Intergenic
1121426614 14:93856708-93856730 TCCCTGAGGAGGGGAAGGAGGGG + Intergenic
1121585798 14:95062049-95062071 CCCCTCAGGTGGGCTGGGCCTGG + Intergenic
1122324862 14:100875913-100875935 CCCCGCAGCAGGGCTCTGAGCGG + Intergenic
1122631897 14:103111161-103111183 CCACTGTGGAGGGCTGGGAGGGG - Intergenic
1123014508 14:105367393-105367415 CCCCACAGCAGGGGCAGGAGCGG - Intronic
1123118931 14:105908189-105908211 TCCCTCAGGGGCCCTAGGAGAGG + Intergenic
1125716452 15:41822468-41822490 CCTCTCAGGTAGGCAAGGAGGGG - Intronic
1126356761 15:47804221-47804243 CTCCTCAGGTGAGCCAGGAGTGG + Intergenic
1128288074 15:66455067-66455089 CCCCTAAATAAGGCTAGGAGAGG - Intronic
1128450761 15:67804787-67804809 CCTCTCAGGAGGCTCAGGAGGGG - Intronic
1129524369 15:76204508-76204530 CCCCTGAGCAGGGCGAGAAGAGG - Exonic
1130127784 15:81108478-81108500 CCCCTCAGGAGGAAGAGCAGGGG - Intronic
1132017366 15:98330720-98330742 CCCCTCAAGAGAGACAGGAGAGG + Intergenic
1133236118 16:4388177-4388199 CCCCAGAGCAGGGCTTGGAGTGG + Intronic
1133236385 16:4389223-4389245 CACCTCGGGAGGGCCAGGAGAGG - Intronic
1133808280 16:9142089-9142111 CGCCTCATGAGGATTAGGAGAGG + Intergenic
1134584554 16:15398702-15398724 CTACTCAGGAGGGGCAGGAGAGG - Intronic
1135495200 16:22945409-22945431 CCCCTCAAGAGTGCAAGCAGAGG - Intergenic
1137866721 16:51905249-51905271 GCCCTCAGGATGGTGAGGAGAGG - Intergenic
1138910414 16:61390529-61390551 CCCCTTAGAAGGCCTAGGAGTGG + Intergenic
1139422226 16:66855852-66855874 CCCCACTGCAGGGCCAGGAGGGG + Intronic
1140454673 16:75098122-75098144 TCCTACAGGAGGGCGAGGAGGGG + Intronic
1140878237 16:79173221-79173243 CCCCTCAGGAGGCCCAGGAGGGG - Intronic
1141576064 16:84964185-84964207 CCCATGAGGAGGGGTGGGAGAGG - Intergenic
1141856435 16:86684541-86684563 CCTCCCAGGTGGGCTAGGAGAGG - Intergenic
1142439020 16:90082423-90082445 CCCCTCATGAGGGCTTGGGCTGG + Intronic
1142718871 17:1763141-1763163 CCCCTCCGGAGAGCCAGGGGAGG + Intronic
1142901278 17:3013314-3013336 CCCATCAGGAGGAAAAGGAGGGG - Intronic
1143397406 17:6612242-6612264 CTTCTCAGCAGGGCTAGGATAGG - Intronic
1144621021 17:16818621-16818643 ACCCTCCTTAGGGCTAGGAGAGG - Intergenic
1145399176 17:22517345-22517367 GGCCTCCGGAGGGCTGGGAGGGG - Intergenic
1145764679 17:27450248-27450270 CCCCTCAGGGTGGCTGAGAGAGG - Intergenic
1146400446 17:32496744-32496766 CCCTCCAGGAGGGCGAGCAGGGG - Intronic
1147037335 17:37691520-37691542 CCGCTCAGGGGTGCTAGCAGGGG + Intronic
1147572999 17:41582914-41582936 ACCCTCCTTAGGGCTAGGAGAGG - Intronic
1148072297 17:44915432-44915454 CCCCTGAGGAGACGTAGGAGCGG + Exonic
1148488003 17:48003598-48003620 CCCCTGAGAGGGGCCAGGAGTGG + Intergenic
1149938902 17:60841795-60841817 GCCCTTAGGAAGGCTAGAAGTGG - Intronic
1151380745 17:73724206-73724228 CTGCTCAGCAGTGCTAGGAGAGG + Intergenic
1151487109 17:74407872-74407894 CAGCTCAGGAGGCTTAGGAGTGG + Intergenic
1151675599 17:75595839-75595861 CGCCTCAGGACAGCCAGGAGGGG + Intergenic
1152229964 17:79109525-79109547 CCCCTCCGGAGGTCTAGCATAGG - Intronic
1152781145 17:82227979-82228001 CCCCTCCAGAGGGCAAGGGGAGG - Intergenic
1152804098 17:82346890-82346912 CTCCCCAGGAGGGCTCCGAGGGG + Intergenic
1154353776 18:13609414-13609436 CCCCTCAGAGGCGCTGGGAGAGG + Intronic
1155963978 18:32019059-32019081 CCCCTAAGGAGGGCGATGTGGGG + Intronic
1157485602 18:48084712-48084734 CCCCTGAGGAGGGCAAGAAGTGG - Intronic
1158028578 18:52933996-52934018 CTTCTCATGAAGGCTAGGAGGGG - Intronic
1158029773 18:52949386-52949408 CCCCTAAGTAGGGGCAGGAGGGG - Intronic
1160537993 18:79605559-79605581 CTGCGCAGGAGGGCGAGGAGGGG - Intergenic
1160811235 19:1013807-1013829 CACCTCAGGACGGCCAGGATGGG + Intronic
1161058950 19:2204848-2204870 CCCCTCAGGAGGAGCAGGAAGGG - Intronic
1161075524 19:2283307-2283329 CCCCTGAGAAGGGGCAGGAGGGG + Intronic
1161133667 19:2606973-2606995 CACCTCAGGAGGCCGAGGCGGGG + Intronic
1162757882 19:12871151-12871173 CCGCCAAGGAGGGCCAGGAGAGG + Exonic
1162799837 19:13104349-13104371 CCACTCTGGAGGGCAGGGAGGGG + Intergenic
1162824831 19:13244991-13245013 CCCCTCAGGAGGGCATTGTGGGG - Intronic
1163270101 19:16247907-16247929 ACCCTCAGGAAGGATAGCAGTGG - Intergenic
1164682496 19:30145085-30145107 CCCCTCAGAAGGGCCTGGCGGGG - Intergenic
1164941152 19:32253027-32253049 GCCCTCAGGAGGCCTTGGCGGGG - Intergenic
1165773008 19:38389281-38389303 CCCTTCAGGAGGGGAAGGGGCGG - Intronic
1167078653 19:47264595-47264617 CCCCCCAGGAGTGGGAGGAGCGG + Exonic
1167593798 19:50417438-50417460 CCCCTCTGGGGGGCTGGGATGGG - Intronic
1168306799 19:55440398-55440420 GTCCACAGGAGGGCAAGGAGAGG + Intronic
925906199 2:8540885-8540907 CCCTTCAGAAGGGCAAGGGGAGG + Intergenic
926084115 2:10010299-10010321 CCCCTGAGCAGGGCCAGGTGTGG + Intergenic
926319442 2:11738660-11738682 CACCTCAGCAGTGCCAGGAGAGG + Intronic
926400035 2:12487753-12487775 CCCTGCAGGATGGCCAGGAGAGG - Intergenic
927176990 2:20417121-20417143 CCCATGAGGAGGTCTTGGAGGGG + Intergenic
928108839 2:28490290-28490312 CCCTTCAGGACTGCCAGGAGGGG + Intronic
928130400 2:28644889-28644911 CCCCTCATTAGGGCTTGGGGAGG + Intergenic
928167644 2:28982337-28982359 TTCCTCAGGAGCGCTGGGAGGGG + Intronic
931666520 2:64613108-64613130 TCCCTCAAGAGGGCTAGAGGTGG + Intergenic
932583127 2:73005496-73005518 CCTCTCAGGATGGTTATGAGAGG + Intronic
935069688 2:99683025-99683047 CCCATCAGGAGGGCCAGGGAAGG - Intronic
936079808 2:109424335-109424357 CCCCTCTGAAGGGCGATGAGTGG - Intronic
937662956 2:124451940-124451962 ACCTTCAGGAGGGCTACCAGAGG + Intronic
941470905 2:165885556-165885578 CACCTCAGGTGGGCCAGGAGAGG + Intronic
943475798 2:188353823-188353845 GCCCTCTGTAGGGGTAGGAGGGG - Intronic
945591189 2:211733789-211733811 ACCCACAGAAGGGCCAGGAGTGG + Intronic
945977198 2:216280195-216280217 ACTCACAGGAGGGCTGGGAGGGG + Intronic
1169804723 20:9547698-9547720 CCCTTCAGGAGGGATGGGATGGG + Intronic
1172107747 20:32526937-32526959 CCCCTCTGCAGGGTGAGGAGGGG + Intronic
1172435902 20:34928759-34928781 CCCCTCAGGAGGGCTAGGAGAGG + Exonic
1172767470 20:37358528-37358550 CGCCTGAAGAGGGCAAGGAGAGG - Intronic
1175148886 20:56917414-56917436 CCCCTCAGGCTGAGTAGGAGGGG + Intergenic
1175915359 20:62423458-62423480 CAGCTGAGGAGGGCCAGGAGGGG + Intronic
1178103905 21:29298533-29298555 GCCCTCAGAAGGGAGAGGAGAGG + Intronic
1178690034 21:34743043-34743065 CCCCCCAGGAGGGGCTGGAGCGG + Intergenic
1179558415 21:42195243-42195265 CCCCTCAGGAGAGCTGGGGGTGG + Intergenic
1180954008 22:19733378-19733400 CCTCTCAGGAGGGATGGAAGAGG - Intergenic
1182083047 22:27542836-27542858 CCCCTTGGGAGGACTTGGAGAGG + Intergenic
1182666915 22:31966810-31966832 CCCCACAGGAGCTCTGGGAGGGG + Intergenic
1183292297 22:37010254-37010276 CCCCAAAGGAGGTCTAAGAGAGG + Intergenic
1183432888 22:37776144-37776166 GCCCTGAGGAGGGATGGGAGGGG - Exonic
1184130234 22:42513121-42513143 CCCCACAGCAGAGCTGGGAGGGG - Intronic
1184140410 22:42574944-42574966 CCCCACAGCAGAGCTGGGAGGGG - Intergenic
1184594485 22:45505483-45505505 GCACTCAGCAGGGCCAGGAGCGG - Intronic
1185413242 22:50696962-50696984 GCCCACAGGAGGGGAAGGAGAGG + Intergenic
950441635 3:13014192-13014214 CCCCTCAGGCTGGTTAGGGGAGG - Intronic
954603755 3:51893002-51893024 CCACTGAGGAGGCCTGGGAGTGG + Intergenic
954653785 3:52181665-52181687 CCACCCAGGAGGGCCAGGACAGG + Intergenic
954807964 3:53231267-53231289 ACCCTCTGGAGGGCTGGGAAAGG - Intronic
956121703 3:65972627-65972649 CCCCCCTGAAGGGCTAGGACTGG + Intronic
962156305 3:132952345-132952367 CCTCCCAGGAGAGCCAGGAGAGG + Intergenic
965516761 3:169629964-169629986 CTCCGCAGAAGGGCTGGGAGAGG - Intronic
967812965 3:193775809-193775831 CCCCGCAGGAGAGGGAGGAGGGG + Intergenic
967877574 3:194277418-194277440 CCACTGGGGAGGGCAAGGAGGGG + Intergenic
968025914 3:195442612-195442634 CCCCTCGGGAGGGCTCGGTGGGG + Intronic
968519281 4:1028422-1028444 CCCCTGAGGAAGGCTAGGGAAGG - Intergenic
968602523 4:1517073-1517095 CCCCTGAGGAGGGGTGGCAGAGG - Intergenic
968832752 4:2941619-2941641 TCCGTGAGGAGGGCTTGGAGAGG + Exonic
968984820 4:3869404-3869426 TCCCTCAGGAGGCCTTGGCGAGG + Intergenic
985634141 5:1027742-1027764 GCCCTCACGAGGCCCAGGAGGGG + Intronic
985967790 5:3350956-3350978 CCACTCAGGAGGCCCAGGTGAGG - Intergenic
986292791 5:6413262-6413284 GTCCTCAGGAGGGGCAGGAGAGG - Intergenic
987087922 5:14487311-14487333 CCCATCAGGAGAGCTAGAAGAGG - Intronic
999244700 5:150147635-150147657 CCGCCCAGGAGGGCTCTGAGGGG - Intronic
1000230081 5:159307672-159307694 CCCCTCAGAAGAGGTAGGTGTGG - Intergenic
1000379219 5:160614078-160614100 CCCCTCAAGATGGCTTGGAGAGG - Intronic
1001425890 5:171622128-171622150 TGGCTCAGGAGGGCTAGGAAAGG + Intergenic
1002509688 5:179705941-179705963 CTACTCAGGAGGCCTAGGACAGG + Intronic
1002635279 5:180604397-180604419 CTCCGCAGGAGGGCCAGGAATGG - Intronic
1002696143 5:181092451-181092473 GACCTCAGGAGGGCCAGGGGTGG - Intergenic
1002928270 6:1617565-1617587 CCCCTGAGCTGGGCTCGGAGTGG - Intergenic
1006377661 6:33680484-33680506 CCCCCCAGGAGGTGTGGGAGTGG + Intronic
1007339163 6:41179489-41179511 CCCCACAGGAGGGGTATGTGAGG - Intergenic
1007547955 6:42708500-42708522 CCCCTCCAGAGGGCCAGTAGAGG - Intronic
1007687139 6:43673659-43673681 CCCTTCAGGAGAGGTAGGAAGGG - Intronic
1007721570 6:43888360-43888382 CCTCTCAGTAGGGCAAGGCGGGG - Intergenic
1008563290 6:52743116-52743138 CACCTGAGCAGGGCTAGCAGAGG - Intergenic
1008881773 6:56387559-56387581 GCACTGAGGAGGGCTGGGAGAGG - Intronic
1017810676 6:157981660-157981682 CCCCGCAGGCGGGCGTGGAGCGG - Intergenic
1019478858 7:1256912-1256934 CACCTCATGTGGGCTGGGAGCGG - Intergenic
1019713467 7:2527840-2527862 CCACTCAGAAGAGCTGGGAGGGG - Exonic
1020013384 7:4818133-4818155 CCCCACAGGAGGGAGAGGAGGGG - Intronic
1021912170 7:25397113-25397135 CCACTTAGGTGAGCTAGGAGGGG + Intergenic
1022515154 7:30970567-30970589 CCCCACAGGAGAGCTGGGATTGG + Intronic
1024570919 7:50722231-50722253 CCACTCAGGAGGCCAAGGACTGG + Intronic
1029484089 7:100828750-100828772 GCCCTCGGGATGGCTGGGAGGGG + Intronic
1029793136 7:102866414-102866436 GGCCTGAGGAGGACTAGGAGAGG + Intronic
1033413841 7:141145234-141145256 CTCCTGAGGAGGGCTTGAAGAGG + Intronic
1034842594 7:154413044-154413066 TCCCTCAGGAGGGCTGGGATGGG - Intronic
1035553135 8:544989-545011 GTCCTGAGGAGGGCTTGGAGCGG - Intronic
1036507837 8:9371815-9371837 CCCCTCAGGAAGACAAGCAGGGG + Intergenic
1036592129 8:10178342-10178364 CACTTCGGGAGGCCTAGGAGGGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038777316 8:30542834-30542856 ACCCTCAGAGGGGCTGGGAGGGG - Intronic
1041988153 8:63952235-63952257 CCCCTCAGCATGGCAAGAAGAGG - Intergenic
1044897649 8:96909702-96909724 CCCCAGAGGAGAGCTGGGAGTGG + Intronic
1046289439 8:112137551-112137573 TCCCTCTGAAGGCCTAGGAGAGG - Intergenic
1047423614 8:124727285-124727307 CCCCGCGGGAGGGCTAAGAGAGG + Intronic
1047768485 8:128010666-128010688 CCCCTCAGCAGACTTAGGAGAGG + Intergenic
1047902885 8:129442961-129442983 AGCCTCTGGAGGGTTAGGAGGGG + Intergenic
1049220873 8:141428292-141428314 CCTCTAAGGAGGGCGGGGAGGGG - Intronic
1049469989 8:142770934-142770956 CCCCTCAGGGGTGCTGGGTGGGG + Intronic
1050336860 9:4597757-4597779 CCGCTAAGTAGTGCTAGGAGGGG + Intronic
1054740616 9:68802603-68802625 TGCCTCAGGAGGGGTAGGAGAGG + Intronic
1055766963 9:79673895-79673917 CCCCCCAGGAAGGCATGGAGAGG - Intronic
1056623826 9:88237587-88237609 CACCTCAGCAAGGCCAGGAGTGG - Intergenic
1056759150 9:89402797-89402819 CCCCACAGTGGGGCCAGGAGAGG + Intronic
1056800507 9:89687486-89687508 CCTGTCAGGAGGGGCAGGAGGGG + Intergenic
1060822922 9:126671858-126671880 CCCCTCTGGAGGGAGGGGAGTGG - Intronic
1061429282 9:130520990-130521012 CCCCATGGGAGGGCTGGGAGCGG + Intergenic
1061484653 9:130914217-130914239 CCCCTCGGGAGGGCTGGGGGAGG - Intronic
1061719881 9:132544994-132545016 CCCCTCAGCAGAGCAAGGAAAGG + Intronic
1061912476 9:133732391-133732413 CCCCTGCGGGGGGCAAGGAGGGG - Intronic
1062428580 9:136517096-136517118 CCCCTCAGGAGGCCGGGGTGCGG + Intronic
1190618885 X:52265641-52265663 CCCCTCAGAAGGGACTGGAGGGG - Intergenic
1194560533 X:95413416-95413438 CCTATCAGGAGGGCAAGGAGAGG - Intergenic
1200061078 X:153484067-153484089 TCCCTCCGGAGGCCTAGGATGGG + Intronic
1200951293 Y:8902306-8902328 CCCCTCAGGGAGACTAGAAGAGG - Intergenic
1201911925 Y:19141535-19141557 CCTCTGAGGAGAGCCAGGAGAGG - Intergenic