ID: 1172436324

View in Genome Browser
Species Human (GRCh38)
Location 20:34931287-34931309
Sequence CCTGCTAGTCCCTCTCATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 149}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172436319_1172436324 9 Left 1172436319 20:34931255-34931277 CCAGAGTAAGTGCCAATGAGCAC 0: 1
1: 0
2: 0
3: 11
4: 89
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1172436316_1172436324 22 Left 1172436316 20:34931242-34931264 CCCGGGACTGTGCCCAGAGTAAG 0: 1
1: 0
2: 0
3: 18
4: 216
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1172436315_1172436324 27 Left 1172436315 20:34931237-34931259 CCATGCCCGGGACTGTGCCCAGA 0: 1
1: 0
2: 2
3: 21
4: 254
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1172436312_1172436324 30 Left 1172436312 20:34931234-34931256 CCCCCATGCCCGGGACTGTGCCC 0: 1
1: 0
2: 2
3: 36
4: 372
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1172436318_1172436324 10 Left 1172436318 20:34931254-34931276 CCCAGAGTAAGTGCCAATGAGCA 0: 1
1: 0
2: 0
3: 15
4: 142
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1172436321_1172436324 -3 Left 1172436321 20:34931267-34931289 CCAATGAGCACTGGCCACAGCCT 0: 1
1: 0
2: 1
3: 33
4: 224
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1172436314_1172436324 28 Left 1172436314 20:34931236-34931258 CCCATGCCCGGGACTGTGCCCAG 0: 1
1: 0
2: 0
3: 22
4: 263
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1172436313_1172436324 29 Left 1172436313 20:34931235-34931257 CCCCATGCCCGGGACTGTGCCCA 0: 1
1: 0
2: 3
3: 22
4: 263
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149
1172436317_1172436324 21 Left 1172436317 20:34931243-34931265 CCGGGACTGTGCCCAGAGTAAGT 0: 1
1: 0
2: 1
3: 11
4: 168
Right 1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG 0: 1
1: 0
2: 0
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172436324 Original CRISPR CCTGCTAGTCCCTCTCATTG AGG Intronic
901884947 1:12216209-12216231 CCCGCTAGTGCCTCTCCTTGTGG + Intergenic
902705547 1:18201687-18201709 CCTCCTCTGCCCTCTCATTGGGG + Intronic
903623770 1:24716666-24716688 CCTGCTAGGCCCTCTGTCTGGGG + Intergenic
904470857 1:30735385-30735407 CCTGCTCGGACCTCTCATTCTGG + Intronic
905335580 1:37242420-37242442 CATCCTAGTCCCTCTCATACTGG + Intergenic
906795809 1:48695695-48695717 CCTCTGAGTCCCTCTCACTGAGG - Intronic
906798164 1:48713780-48713802 CCTGCTATTCCCTCTCATCTGGG + Intronic
906873299 1:49508555-49508577 CCTGGATGTCTCTCTCATTGTGG - Intronic
908256792 1:62309759-62309781 CCTGTTAGTCCATCGCAGTGTGG - Intronic
910624577 1:89292862-89292884 CCTTCTGGTGCCTCTCAATGTGG - Intergenic
910808316 1:91210805-91210827 CCTGCCAGTCCCTCCCCTAGGGG - Intergenic
912275105 1:108248084-108248106 CACGCCAGTGCCTCTCATTGGGG - Intergenic
912293117 1:108446265-108446287 CACGCCAGTGCCTCTCATTGGGG + Intronic
912520762 1:110243212-110243234 CTTGCTAGGGCCTCTCACTGTGG + Intronic
913968945 1:143399393-143399415 CCTGCTACTCCTTCTTATTTGGG + Intergenic
914063323 1:144224992-144225014 CCTGCTACTCCTTCTTATTTGGG + Intergenic
914115827 1:144741362-144741384 CCTGCTACTCCTTCTTATTTGGG - Intergenic
915128726 1:153682760-153682782 CCTGTGAGTCCCTATCATTCTGG - Intronic
917276290 1:173335294-173335316 CCTTCTAGAGCCTCTCATTATGG - Intergenic
921334601 1:214073765-214073787 CCTGTTGGTGCCTGTCATTGTGG - Intergenic
1063171075 10:3510510-3510532 CCAGCCAGTCCCTCTCATGCCGG - Intergenic
1063379705 10:5576701-5576723 GCTGCCACTCCCTCTCAGTGGGG + Intergenic
1063577501 10:7275070-7275092 CCTGCCTGTGCCTCTCTTTGTGG - Intronic
1068879845 10:62036466-62036488 GCTGCTAGTACCTCACATTTGGG + Intronic
1071555333 10:86597279-86597301 CCTGCAAGGCCCTCGCCTTGAGG + Intergenic
1072301993 10:94070707-94070729 CCTGCTATTCACTTTAATTGGGG + Intronic
1072479938 10:95801136-95801158 CCAGCTGGTCCCTCTGTTTGGGG + Intronic
1074770311 10:116729290-116729312 CCTGAAAGTCCCTCCCTTTGGGG + Intronic
1077145351 11:1041972-1041994 CCTGCCAGGCCCTCACAGTGGGG + Intergenic
1081573889 11:44307680-44307702 CCAGCTCGTCCCTGTCATTCAGG - Intronic
1083547930 11:63562918-63562940 CCAGCTAATCCCTCCCACTGAGG + Intronic
1087083286 11:94192789-94192811 GCTGCTAGTCCTTCTCATAAAGG + Intergenic
1091014247 11:132035744-132035766 TCTGTCAGTCCCTCTGATTGAGG + Intronic
1091820787 12:3473829-3473851 CCTGCTTCTCCCTCTCATCCTGG + Intronic
1094417141 12:30229161-30229183 CCTCCTAGTTCCTCCCAGTGTGG + Intergenic
1097053910 12:56238988-56239010 CCTGCTAGGCCCTTTCCCTGGGG - Exonic
1098497130 12:71149574-71149596 CCAGCCAGTCCCTCTGTTTGGGG - Intronic
1099995843 12:89777677-89777699 CCTTCTAGTCCCTCTCTATGGGG + Intergenic
1100235096 12:92652876-92652898 TCTGCCTGTCCCTCTCATTGGGG - Intergenic
1100365867 12:93919860-93919882 ACTGCTACTCCCTCTCTTTGAGG - Intergenic
1101334067 12:103781015-103781037 TCTGCTCTTCCTTCTCATTGAGG - Intronic
1101674876 12:106908625-106908647 CTAGCTGGACCCTCTCATTGAGG + Intergenic
1105244348 13:18635194-18635216 CCAGCTGGTCCCTCTGTTTGGGG - Intergenic
1110529053 13:76575325-76575347 CCAGCCAGTCCCTCTGTTTGGGG - Intergenic
1110927309 13:81170158-81170180 CCTGCTACTCCCTCCCCTAGGGG + Intergenic
1112252401 13:97794254-97794276 CCAGCCAGTCCCTCTCTTCGGGG + Intergenic
1113044180 13:106136832-106136854 CCTGCTCATTCCTCTCTTTGAGG - Intergenic
1114338859 14:21722026-21722048 CCTGCTAATACCTCCCACTGGGG - Intergenic
1116265152 14:42678970-42678992 ACTGCAAGTCACTATCATTGTGG + Intergenic
1119128978 14:72154489-72154511 CCAGCCAGTCCCTCTGTTTGGGG + Intronic
1123044597 14:105505196-105505218 CCTGCTGGTCCCTCTCCTTCGGG - Intergenic
1126374722 15:47985694-47985716 CCTGATAAGCCCTCTCACTGTGG - Intergenic
1126464685 15:48951063-48951085 CCTGCTCTACCCTCTCCTTGTGG + Intronic
1128513201 15:68326325-68326347 CCTGCTTATCCCTCCCTTTGGGG + Intronic
1128713268 15:69887878-69887900 CCTGCTGGTCCCTCTGCCTGGGG - Intergenic
1130328881 15:82904221-82904243 CCTGCTTGTCTCTCTAATTTTGG - Intronic
1135083548 16:19456616-19456638 CCTGCGAGTCCCAATCAATGCGG + Intronic
1136549906 16:30977464-30977486 CCTGCCCATCCCTCTCATTTAGG - Intronic
1137667461 16:50260024-50260046 TCTGCGAGTCCCTCTCCCTGGGG + Intronic
1139611845 16:68064740-68064762 CCTGCCAGTCCCTGGCATTTGGG + Intronic
1141386148 16:83624148-83624170 TCTGCTAGGCTCTCTCCTTGTGG + Intronic
1143590067 17:7879751-7879773 CCTGCCTGTCACTTTCATTGTGG - Intronic
1145784518 17:27585455-27585477 CCTTCTAGTCCTTTCCATTGAGG + Intronic
1145864874 17:28234709-28234731 CCTGCAAATCTCTCTCCTTGTGG + Intergenic
1146212964 17:30956387-30956409 CCTGCTGTTCCTTCTCACTGGGG - Exonic
1146522149 17:33534051-33534073 CTTCCCAGTCCATCTCATTGTGG + Intronic
1146786249 17:35724489-35724511 CCTGCTAATCCCACTAATTCAGG + Intronic
1148291386 17:46453337-46453359 CATGCTAGTCTCTCTCTTTGGGG + Intergenic
1148313573 17:46671040-46671062 CATGCTAGTCTCTCTCTTTGGGG + Intronic
1149119378 17:53143178-53143200 CCTGCTAGTGACTCCCGTTGAGG + Intergenic
1149531689 17:57400742-57400764 CCTGCAGGTCCTTCTCCTTGGGG - Intronic
1152819578 17:82429931-82429953 CCTGCTGGTCGCTTCCATTGAGG + Intronic
1153237586 18:3003447-3003469 CCTGCTGGTCCCTCTGTTTAGGG - Intronic
1154444589 18:14424710-14424732 CCAGCTGGTCCCTCTGTTTGGGG + Intergenic
1159579698 18:70221204-70221226 TCTGCTTCTCCCTTTCATTGAGG + Intergenic
1162805492 19:13136041-13136063 CCTCCTCGTCCTCCTCATTGTGG - Exonic
1164326490 19:24197266-24197288 CCAGCCAGTCCCTCTGTTTGGGG + Intergenic
1164332870 19:24277370-24277392 TCAGCTCGTCCCTCTGATTGGGG - Intergenic
1165320404 19:35081313-35081335 CCTTCTTGTACCTCTCACTGTGG + Intergenic
1165422382 19:35728661-35728683 CCCGCTACTCCCTCTCTATGTGG - Intronic
1166426928 19:42687327-42687349 CCAGCTGGTCCCTCTGTTTGGGG + Intronic
1167221899 19:48204698-48204720 CCTCCCAGTCCCTCCCATAGAGG - Intronic
930018510 2:46986785-46986807 CCGGCTCGTCCCTCCCATTGAGG + Intronic
932113376 2:69022246-69022268 CCTACTAGTGCTTCTCAATGAGG + Intronic
934173648 2:89560313-89560335 CCTGCTACTCCTTCTTATTTGGG + Intergenic
934283962 2:91634662-91634684 CCTGCTACTCCTTCTTATTTGGG + Intergenic
942866536 2:180682644-180682666 CCAGCTGGTCCCTCTGTTTGGGG + Intergenic
943171481 2:184406643-184406665 CCAGCTGGTCCCTCTATTTGGGG - Intergenic
945022550 2:205588778-205588800 CTTGCTAGTCCATGTCATGGCGG + Intronic
1170164052 20:13344003-13344025 ACTGGTAGTCCCTCTGCTTGTGG + Intergenic
1171197207 20:23209002-23209024 CTTGCTATCCCCTCACATTGCGG - Intergenic
1171294602 20:24006250-24006272 CTTGCTGGTCCCTCTCGCTGAGG - Intergenic
1172436324 20:34931287-34931309 CCTGCTAGTCCCTCTCATTGAGG + Intronic
1176218021 20:63957368-63957390 TATGCTGGTCCCTCTCACTGAGG + Exonic
1179340205 21:40500817-40500839 CCTGCTGATGCCTCCCATTGTGG + Intronic
1182101022 22:27657429-27657451 TCTGCTAGACCCTCTCTTGGGGG - Intergenic
1183722084 22:39568560-39568582 CCCGCTCTTCCCTCTCACTGGGG - Intergenic
949272800 3:2239461-2239483 CCTGCTAGGCCATCACATTATGG + Intronic
949507405 3:4740496-4740518 CTTGCTAGGCACTCTCATGGAGG + Intronic
951081069 3:18450387-18450409 CCAGCCAGTCCCTCTGTTTGGGG + Intergenic
951163008 3:19449320-19449342 CCTGCTGGTGCATCTCATGGTGG + Intronic
951978561 3:28541491-28541513 CCAGCTGGTCCCTCTGTTTGGGG + Intergenic
953846514 3:46431561-46431583 CCAGCTGGTCCCTCTCTTCGGGG - Intergenic
960942377 3:122943299-122943321 TCTGCTGGGCCCTCTCCTTGTGG - Intronic
961543446 3:127616355-127616377 CTTCCTAGTCCCTCCCTTTGTGG + Intronic
962653776 3:137521742-137521764 GCTGCAAGTACCTTTCATTGTGG + Intergenic
962923994 3:139975186-139975208 CCTGCTACTCCCCCTCCTTAGGG - Intronic
966806492 3:183811653-183811675 CCTGCCACTCCCTCCCATCGAGG - Exonic
969492729 4:7509346-7509368 CCTGCTGGAGCCTCCCATTGTGG + Intronic
970719648 4:18971448-18971470 CCAGCTGGTCCCTCTGTTTGGGG + Intergenic
971244059 4:24912831-24912853 CCTGCCAGTCGCTCTCAGTCCGG + Exonic
974164701 4:58186176-58186198 CCAGCCAGTCCCTCTGTTTGGGG + Intergenic
978467221 4:109021326-109021348 CCAGCCAGTCCCTCTGTTTGGGG - Intronic
986653235 5:9985792-9985814 CCTGCTGGTCCATTGCATTGTGG + Intergenic
986969029 5:13310741-13310763 CCTGCAATTCCCTCTCCTTGAGG - Intergenic
989387046 5:40864406-40864428 CCAGCTGGTCCCTCTGTTTGGGG - Intergenic
989420222 5:41229883-41229905 CCAGCTGGTCCCTCTGTTTGGGG - Intronic
993055424 5:82974805-82974827 CCTGCTGGTCCCTCCCCTAGGGG - Intergenic
995696573 5:114884517-114884539 CTTGTTAGGCCCTCTCATTCTGG - Intergenic
995969618 5:117952374-117952396 CATGCCAGTCCCTGTCACTGTGG - Intergenic
997657317 5:135564907-135564929 TCTGCTAGGCCCTGTCAGTGGGG + Intergenic
1013023007 6:106238583-106238605 CCTGCTAGTTCCTCCCAGAGAGG - Intronic
1022517714 7:30986672-30986694 CCTGCTCCTCACTCTCACTGCGG - Intronic
1023436650 7:40147164-40147186 CCTGCTGGTCCCTCCCCTAGCGG - Intronic
1024003767 7:45210429-45210451 CCTCCTAGACCCACTCAGTGAGG + Intergenic
1028117292 7:87013535-87013557 CCTGCTGGTACTTCTCAATGTGG - Intronic
1029078206 7:97952379-97952401 CCTGCAACTCTCTCTCCTTGGGG + Intergenic
1029601527 7:101566254-101566276 CCTGTTTGTCCCTCTTCTTGTGG + Intergenic
1030393667 7:108958541-108958563 CGTGATAGTTCCTCTCACTGGGG + Intergenic
1034583916 7:152071800-152071822 TCAGCTAGTCCCTCTGTTTGGGG + Intronic
1035630168 8:1101446-1101468 CCTGTGAGTCGCTCACATTGTGG - Intergenic
1037312623 8:17572858-17572880 CCAGCTAGTCCCTCTGTTCGGGG - Intergenic
1038564947 8:28611892-28611914 CCAGCTAGACCTTGTCATTGGGG + Intronic
1038799103 8:30733173-30733195 CCTGCAAATCTCTCTCCTTGTGG - Intronic
1040751110 8:50709764-50709786 CATCCTCTTCCCTCTCATTGAGG + Intronic
1044323969 8:90839366-90839388 CTTGCTATTCCCTTTCAATGAGG + Intronic
1045136437 8:99224833-99224855 TCTGATTGTCTCTCTCATTGTGG + Intronic
1048465578 8:134662264-134662286 CCTGCTAGGCCATCACATTAGGG + Intronic
1048602224 8:135930688-135930710 CCAGCAAGTCCCTCTGTTTGGGG + Intergenic
1051104900 9:13568508-13568530 CCTGCAGTTTCCTCTCATTGGGG + Intergenic
1054160999 9:61671966-61671988 CCTGCCAGCCCCTCCAATTGTGG - Intergenic
1055120939 9:72660024-72660046 CCTGCCTGTCCTTCTCCTTGAGG + Intronic
1057293361 9:93820929-93820951 CCTGCTTCTCCCTTTCATTCTGG + Intergenic
1057379982 9:94559000-94559022 CCAGCGAGTCCCCCTCATTCTGG - Exonic
1057925969 9:99149383-99149405 CCTTCTGTTCCCTCTCAGTGAGG - Exonic
1058943142 9:109833016-109833038 CCAGCTAGTCCATCCCACTGAGG + Intronic
1060015875 9:120085913-120085935 CCAGCTGGTCCCTCTGCTTGGGG + Intergenic
1062364966 9:136204090-136204112 CCTGCAGGTCCCTCTCCCTGTGG + Intronic
1062510129 9:136900604-136900626 CCTGCACGTTCCTCTCACTGGGG + Intronic
1186845742 X:13529303-13529325 CCTGCAAGTCCATTTTATTGTGG + Intergenic
1192243003 X:69349555-69349577 CCTGCTGGTTTCTCTCACTGGGG + Intergenic
1193359299 X:80561577-80561599 CCTCCTGGTCCCCCTCCTTGGGG + Intergenic
1195281576 X:103339754-103339776 CCTGCCAGTCCATCTCCCTGGGG - Intergenic
1196458026 X:115903529-115903551 CCTGCCTGTCCATCTCATTCTGG + Intergenic
1199350366 X:146793848-146793870 CCACCAGGTCCCTCTCATTGTGG - Intergenic
1200393176 X:155964891-155964913 CCAGCCAGTCCCTCTGTTTGGGG + Intergenic
1200734803 Y:6782692-6782714 CCTGCTGGTCTCTCTCCTAGTGG + Intergenic
1200984464 Y:9291004-9291026 TCTGCAAGGCCTTCTCATTGTGG - Intergenic
1201616803 Y:15909472-15909494 CCAGCTAGTCCCTCCATTTGGGG + Intergenic
1202153031 Y:21860154-21860176 TCTGCAAGCCCTTCTCATTGTGG - Intergenic