ID: 1172437798

View in Genome Browser
Species Human (GRCh38)
Location 20:34942358-34942380
Sequence CCCGGGTCACATGTTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172437798_1172437806 3 Left 1172437798 20:34942358-34942380 CCAGGGGCAACATGTGACCCGGG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1172437806 20:34942384-34942406 CAGGAAAGCACAATCATAGCTGG 0: 1
1: 0
2: 2
3: 25
4: 376
1172437798_1172437807 13 Left 1172437798 20:34942358-34942380 CCAGGGGCAACATGTGACCCGGG 0: 1
1: 0
2: 0
3: 12
4: 159
Right 1172437807 20:34942394-34942416 CAATCATAGCTGGAGTTCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172437798 Original CRISPR CCCGGGTCACATGTTGCCCC TGG (reversed) Intronic
900523335 1:3116590-3116612 CCCGGGACAGAGGCTGCCCCAGG + Intronic
900891202 1:5451033-5451055 CCAGGCGCACATGCTGCCCCTGG - Intergenic
902418686 1:16259930-16259952 CACTGGCCACATGTTGCCCGTGG + Intronic
903042193 1:20539643-20539665 CCTGGGCCACATGTGGCCTCGGG + Intergenic
903137693 1:21320105-21320127 CCCAGGTCACATGCGGCCCACGG + Intronic
903226160 1:21895179-21895201 CCCTGGTCACAGATTGTCCCAGG + Intronic
903542216 1:24102947-24102969 GCAGGGCCACATGTTGCCCCAGG - Intronic
903630642 1:24767131-24767153 CCTGGGCCACATGTGGCCCACGG + Intronic
904916846 1:33976492-33976514 CCTGGGTCAGATGGTGCTCCAGG - Intronic
906036932 1:42756426-42756448 CCGGGGTCACATCTTTCCCTAGG + Intronic
906197769 1:43939487-43939509 CCAGAGTCACCTGTGGCCCCAGG - Intergenic
907831755 1:58070943-58070965 CCCAGTTCACAAGTTTCCCCTGG + Intronic
909582724 1:77256172-77256194 CCTGGGCCACATGTGGCCCATGG - Intergenic
911610757 1:99957166-99957188 CCCAGGTCCCATTTAGCCCCTGG - Intergenic
912399668 1:109379385-109379407 CCTGGGCCACATGTGGCCCACGG + Intronic
915339254 1:155167339-155167361 CCTGGGCCACATGCTGCCCATGG + Intergenic
915908993 1:159900465-159900487 CCAGGGTCACAGTTTTCCCCTGG + Intergenic
915948405 1:160171101-160171123 CCCCAGTCACATCTCGCCCCAGG - Intronic
1064959515 10:20948056-20948078 CCTGGGTCGCATGTGGCCCAAGG + Intronic
1066302287 10:34107731-34107753 CCCAGGCCACATGTGGCCCTTGG + Intergenic
1067474151 10:46555597-46555619 CCCGGGTCACAAGCTGTGCCAGG + Intergenic
1069572848 10:69504813-69504835 CCTGGGTCCCAGGTGGCCCCAGG - Intronic
1076186620 10:128455157-128455179 CCTGGGCCACATGTGGCCCATGG + Intergenic
1076232303 10:128831593-128831615 CCTGGGCCACATGTAGCCCGTGG + Intergenic
1077707894 11:4505713-4505735 CCAGGGTGTCATGTTGCCTCAGG + Intergenic
1080623689 11:34009087-34009109 CCTGGGACACATGCTGCCCATGG + Intergenic
1081296467 11:41395959-41395981 CCTGGGCCACATGTGGCCCATGG - Intronic
1088942346 11:114472468-114472490 CCTGGGTCACATGTGGCCCACGG + Intergenic
1089928423 11:122283551-122283573 CCTGGGTCACATGTGCCCCACGG + Intergenic
1090215412 11:124958277-124958299 CCTGGGCCACATGTGGCCCATGG - Intronic
1092635799 12:10447133-10447155 CCTGGGTCACATGCGGCCCGTGG - Intronic
1097067982 12:56334593-56334615 CCCGGGTAACAAGATGCCCCTGG + Intronic
1097456929 12:59811075-59811097 CTTGGGTCACATGTCACCCCTGG + Intergenic
1099471221 12:83051201-83051223 CCTGGATCACATGTGGCCCGTGG - Intronic
1099942216 12:89202136-89202158 TCTGGGCCACATGTGGCCCCTGG + Intergenic
1100316348 12:93448323-93448345 CCTGGGTCTCATGTTTCCCAGGG - Intergenic
1102570814 12:113825917-113825939 CCCAGGTGAGATGGTGCCCCTGG - Intronic
1103827634 12:123752915-123752937 CCATGGTCACAAGTTGCCCTGGG + Intronic
1104956109 12:132466608-132466630 CCCAGGTCACAGGTGTCCCCAGG - Intergenic
1104970384 12:132528221-132528243 CCAGGCTAACATGCTGCCCCAGG + Intronic
1105368412 13:19782042-19782064 CCCGGGTTCCCCGTTGCCCCGGG - Intronic
1106286250 13:28320455-28320477 CCTGGGCCACATGTGGCCCGCGG - Intronic
1107155543 13:37163054-37163076 CCTGGGCCACATGCTGCCCATGG - Intergenic
1107790478 13:43997248-43997270 CCTGGGTCAGATTATGCCCCTGG - Intergenic
1113456018 13:110449675-110449697 CCCGGGTCACCTCTGGCACCTGG - Exonic
1113463063 13:110495380-110495402 CCTGGGTCACCTCTTTCCCCAGG - Exonic
1113477944 13:110598662-110598684 CCTGGGCCACATGTGGCCCGTGG - Intergenic
1117235880 14:53774078-53774100 CCTGGGCCACATGTGGCCCATGG - Intergenic
1118875590 14:69782210-69782232 CCCTGGACCCATTTTGCCCCTGG - Intronic
1119755461 14:77114836-77114858 CCCTGGGCACAGGTTGCACCTGG + Exonic
1123466078 15:20517009-20517031 CCTGGGCCACATGCTGCCCTCGG + Intergenic
1123652036 15:22484030-22484052 CCTGGGCCACATGCTGCCCTCGG - Intergenic
1123742456 15:23292890-23292912 CCTGGGCCACATGCTGCCCTCGG - Intergenic
1123760869 15:23431596-23431618 CCTGGGCCACATGCTGCCCTCGG + Intergenic
1124276802 15:28332985-28333007 CCTGGGCCACATGCTGCCCTCGG + Intergenic
1124305898 15:28578621-28578643 CCTGGGCCACATGCTGCCCTCGG - Intergenic
1128264256 15:66253538-66253560 CCCGCGTCCCCTGGTGCCCCCGG + Intronic
1129607794 15:77033234-77033256 CCAGGCTCACATGAGGCCCCAGG - Intronic
1132586766 16:708994-709016 CCCGGGTAACAGGGTGCTCCAGG - Intronic
1133318246 16:4897426-4897448 CCCAGGTCACATGGGGCCCAGGG - Intronic
1138201185 16:55089751-55089773 CCTGCGTCACATGTTCCCGCTGG - Intergenic
1138580994 16:57940311-57940333 CCCGGGTCACAGGGTGCTGCTGG - Exonic
1139451350 16:67029838-67029860 CGCGGGTCACTTGTTGCGCGGGG + Intronic
1143964956 17:10750460-10750482 CCCTGATCACAGGCTGCCCCTGG - Intergenic
1145745535 17:27316971-27316993 CCTGGGCCACATGTGGCCCGTGG + Intergenic
1147048523 17:37772930-37772952 CCCAGGCCACATGTGGCCCATGG + Intergenic
1148485362 17:47987437-47987459 TCCGGGTCAGCTGGTGCCCCCGG - Intergenic
1150202003 17:63367317-63367339 CCGGGGACACATGTGGCCCATGG - Intronic
1150442664 17:65203800-65203822 GCCTGGTCCCAGGTTGCCCCTGG + Intronic
1151065416 17:71143603-71143625 CCTGGGTCACATGCAGCCCATGG - Intergenic
1152380135 17:79938118-79938140 CCCGCGGCAGCTGTTGCCCCGGG - Exonic
1153183880 18:2465996-2466018 CCTGGTTCACCTGTGGCCCCAGG - Intergenic
1156803614 18:41149138-41149160 CCTGGGCCACATGTGGCCCATGG + Intergenic
1158404691 18:57150945-57150967 CCAGGGCCAAATGGTGCCCCAGG - Intergenic
1158836480 18:61335336-61335358 CCCTGTTCAGATGTTGCCCAGGG + Intronic
1159250885 18:65874987-65875009 CCTGGGCCACATGTGGCCCGCGG - Intronic
1161881943 19:6961110-6961132 CCCTGTTCACATCTTGCCCCAGG - Intergenic
1164148131 19:22525444-22525466 CTGGGGTCACAGGTTTCCCCTGG - Intronic
1165772413 19:38387069-38387091 CCCGGGACTCATGGTACCCCGGG - Exonic
1167043998 19:47039457-47039479 CCTCGGGCACACGTTGCCCCCGG + Exonic
925165785 2:1714809-1714831 CCTGGGTCAGATGGGGCCCCTGG + Intronic
925402948 2:3588673-3588695 CCTGGGCCACATGCAGCCCCAGG - Intergenic
928458956 2:31451403-31451425 CCAGGATGACATGTTACCCCAGG - Intergenic
931652161 2:64478336-64478358 CGCGGGCCACCTGCTGCCCCGGG + Intergenic
932000276 2:67878632-67878654 CCAGGGTCACTGGTTGCTCCTGG + Intergenic
937978510 2:127596632-127596654 CCAGGATCACATGTTCCCGCTGG + Intronic
938620182 2:133043597-133043619 CCTGGGTCACATGCAGCCCAAGG + Intronic
940351809 2:152699186-152699208 CCTGGGCCACATGTGGCCCATGG - Intronic
941461965 2:165782463-165782485 CCAGGGTCGCATGTGGCCCATGG + Intronic
943523956 2:188993385-188993407 CCTGGTTCAAATGGTGCCCCTGG + Exonic
947144973 2:227056007-227056029 CCTGGGGCACATGGTCCCCCAGG - Exonic
947298605 2:228662926-228662948 CCTGGGTCACATGTGGCCTGCGG - Intergenic
948115430 2:235491897-235491919 CCTGGGCCTCATGTTGCCCGTGG + Intergenic
1169438457 20:5613960-5613982 CCTGGGCCACATGTAGCCCCCGG + Intergenic
1170139025 20:13106737-13106759 CCCTGGTCTCAGGTTGGCCCTGG - Intronic
1172437798 20:34942358-34942380 CCCGGGTCACATGTTGCCCCTGG - Intronic
1175516019 20:59570614-59570636 CCTGGGTCACATGTGGCCCACGG - Intergenic
1175620928 20:60446934-60446956 CCCTGGTCCCATGTGGCCCCTGG - Intergenic
1178256221 21:31054814-31054836 CCAGGGTCACCTGTGGCCTCTGG - Intergenic
1181019578 22:20092296-20092318 CCCTGGTCTCCTGGTGCCCCTGG + Intronic
1182497342 22:30718813-30718835 CCCTGTTCCCATGCTGCCCCAGG - Intronic
1184483940 22:44765132-44765154 CCCGGGCCAGCTGTGGCCCCAGG - Intronic
1184839381 22:47043629-47043651 CCCTGCTCACATGTCTCCCCAGG - Intronic
951041338 3:17991867-17991889 CCTGGGCCACATGTGGTCCCTGG - Intronic
952933720 3:38379352-38379374 CCCGGGACACATGCTGCCAGTGG - Intronic
953399151 3:42597634-42597656 CCTGGGCCACATGTGGCCCCTGG - Intronic
953906321 3:46870096-46870118 TCAGGGACAAATGTTGCCCCAGG + Intronic
956143924 3:66173268-66173290 CCTGGGTCACATGCTTTCCCCGG + Intronic
957614997 3:82515838-82515860 CCTGGGCCACATGCTGCCCATGG + Intergenic
958714567 3:97764321-97764343 TCCGGCGCACATCTTGCCCCAGG + Intergenic
959574740 3:107922468-107922490 CCTGGGCCACATGTGGCCCTTGG + Intergenic
964810177 3:160654669-160654691 TCTGGGTGACATGTTCCCCCAGG - Intergenic
965531185 3:169772525-169772547 CCCGGGACACATGTTCCACGTGG - Intergenic
968480234 4:830029-830051 CCCAGATCTCATGGTGCCCCAGG + Intergenic
969427202 4:7132135-7132157 GCCAGGTCACAGGTGGCCCCAGG + Intergenic
969533615 4:7742353-7742375 CCAGGGTTCCATGTTGCCCGTGG - Exonic
971401038 4:26275494-26275516 CCCGAGTCACATAGTCCCCCTGG - Intronic
972529334 4:39947696-39947718 CCTGGGTCACATGTGACCCACGG + Intronic
976844555 4:89473229-89473251 CCTGGGCCACATGTAGCCCATGG + Intergenic
981610185 4:146585357-146585379 CCTGGGCCACATGTGGCCTCTGG + Intergenic
982227895 4:153182458-153182480 CACGGGCAACATGTTGCCCAAGG - Intronic
993548985 5:89250158-89250180 CCTGGGCCACATGTGGCCCACGG + Intergenic
993719806 5:91311227-91311249 CCTGGGCCACATGTGGCCCGTGG + Intergenic
996563431 5:124855194-124855216 CCTGGGCCACATGTGGCCCTTGG + Intergenic
996833396 5:127764817-127764839 CCTGGGCCACATGTGGCCCACGG + Intergenic
999339647 5:150759021-150759043 CTCGGGTCACGTGATGCGCCGGG - Exonic
1000139408 5:158387361-158387383 CCTGGGCCACATGTAGTCCCTGG + Intergenic
1000219226 5:159196152-159196174 CCTGGGCCACATGTAGCCCATGG - Intronic
1003183403 6:3810770-3810792 CCTGTGTCACTTGCTGCCCCTGG + Intergenic
1010439801 6:75880559-75880581 CCTGGGCCACATGTGGCCCATGG + Intronic
1011253934 6:85402356-85402378 CCCAGGCCCCATCTTGCCCCAGG + Intergenic
1011335795 6:86258329-86258351 CCTGGGCCACATGTGGCCCGTGG + Intergenic
1019404398 7:876249-876271 CCCGGGTCACGTGCCGCTCCCGG + Intronic
1019404443 7:876398-876420 CCTGGGTCACGTGTTGCCTGCGG + Intronic
1019404452 7:876428-876450 CCTGGGTCACGTGTTGCCTGCGG + Intronic
1019404461 7:876458-876480 CCTGGGTCACGTGTTGCCTGCGG + Intronic
1019947843 7:4344239-4344261 CCTGGCTCACATTTTGCCCGGGG + Intergenic
1020092708 7:5350288-5350310 CCCGGGGCCCATGTTCCCCTGGG - Intronic
1023919916 7:44620665-44620687 CCTGGGCCACATGTGGCCCACGG - Intronic
1025093478 7:56081227-56081249 CCCGGGTCACAGGCTTCACCCGG + Exonic
1027972593 7:85104548-85104570 ATCGGGTCAAATGTTTCCCCAGG - Intronic
1029340921 7:99944024-99944046 CCTGGGTACCCTGTTGCCCCAGG - Intergenic
1030307990 7:108038571-108038593 CCTGGGCCACATGTGGCCCCTGG - Intronic
1032436055 7:131901131-131901153 CCCAGTTCCCATGTTACCCCTGG - Intergenic
1036413125 8:8520807-8520829 CCTGGGGCACATGTGGCCCATGG + Intergenic
1036585072 8:10116181-10116203 CCTGGGCCACATGTGGCCCACGG - Intronic
1037819978 8:22130796-22130818 CCCGGGGCGCGTGTTCCCCCCGG - Exonic
1042833382 8:73055672-73055694 CCCGGGTGAGGTGATGCCCCAGG - Intergenic
1042951914 8:74209257-74209279 CCTGGGTCACATGTAGCCCGTGG - Intergenic
1045264455 8:100607323-100607345 CCCAGGTCACCAGCTGCCCCAGG - Intronic
1046013930 8:108583452-108583474 TCAGTGTCACATGTTGCCCTAGG - Intergenic
1047005621 8:120617024-120617046 CCCGGGCCACATGTGGCCCATGG - Intronic
1047229651 8:122985598-122985620 CCTGGTTCTCATGTTGACCCTGG - Intergenic
1049322122 8:142002105-142002127 CCTGGGTCACATGTGGTGCCTGG + Intergenic
1049354292 8:142179972-142179994 CCTGGGCCACAGGTGGCCCCAGG + Intergenic
1054720151 9:68595904-68595926 CCTGGGTCACATGTGGCCTGTGG + Intergenic
1055027692 9:71739688-71739710 CCTGGGCCACATGTGGCCCACGG - Intronic
1055830663 9:80374777-80374799 CCTGGGCCACATGTGGCCCATGG - Intergenic
1056710189 9:88986256-88986278 CCCTGGTTACATCTTGCCCAGGG - Intergenic
1058586667 9:106514470-106514492 CCTGAGCCACATGTAGCCCCTGG + Intergenic
1058797589 9:108513423-108513445 CCTGGGCCACATGTGGCCCATGG - Intergenic
1061059578 9:128243714-128243736 CCCAGGTCACATGGTCTCCCTGG - Intronic
1061942839 9:133892245-133892267 CCCGGGACACCTGTTCCCACTGG - Intronic
1062503460 9:136861168-136861190 CCCAGGTCACCAGGTGCCCCAGG + Intronic
1062540793 9:137040850-137040872 CCCGGTGCACATGTCGCCCCTGG - Exonic
1187853828 X:23617585-23617607 CCAGGATGACATGTTGACCCTGG - Intergenic
1188658119 X:32723955-32723977 CCTGGGCCACATGTAGCCCATGG + Intronic
1190477314 X:50840876-50840898 CCTGGGTCACATGCAGCCCATGG - Intergenic
1193418378 X:81252696-81252718 CCTGGGCCACATGTGGCCCTTGG + Intronic
1197128954 X:122981532-122981554 CCTGGGCCACATGTGGCCCATGG - Intergenic
1199182743 X:144878161-144878183 CCCGGGCTCCATGTTGCTCCTGG - Intergenic
1202192507 Y:22259540-22259562 ACCTGGTTACATGTTGTCCCAGG + Intergenic