ID: 1172437941

View in Genome Browser
Species Human (GRCh38)
Location 20:34943187-34943209
Sequence TAGCTCTACCACTCACTAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 4, 3: 42, 4: 252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172437938_1172437941 3 Left 1172437938 20:34943161-34943183 CCAACTCTAGACCTGGGTTCAAA 0: 1
1: 0
2: 3
3: 12
4: 116
Right 1172437941 20:34943187-34943209 TAGCTCTACCACTCACTAGTAGG 0: 1
1: 0
2: 4
3: 42
4: 252
1172437939_1172437941 -8 Left 1172437939 20:34943172-34943194 CCTGGGTTCAAATCCTAGCTCTA 0: 9
1: 103
2: 565
3: 1884
4: 4210
Right 1172437941 20:34943187-34943209 TAGCTCTACCACTCACTAGTAGG 0: 1
1: 0
2: 4
3: 42
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172437941 Original CRISPR TAGCTCTACCACTCACTAGT AGG Intronic
902265756 1:15262433-15262455 TAGCTCTCCTACTTCCTAGTGGG - Intronic
902536647 1:17122762-17122784 TGGCTCTGCCCCTCACTAGCTGG + Intergenic
904883491 1:33718120-33718142 TAGCTCTACCACATACTAGCTGG - Intronic
905117221 1:35652899-35652921 TGACTCTACCACTTACTAGCTGG + Intergenic
905285681 1:36878733-36878755 TGGCTCTGGCACTCACTAGCTGG + Intronic
906376688 1:45302300-45302322 TAGCTAAACAAGTCACTAGTGGG + Intronic
906624034 1:47310136-47310158 TAGCTCTACCACTTGTTAGGTGG - Intronic
906672768 1:47668718-47668740 TAGCTCTACCACATTCTAGCTGG - Intergenic
907175019 1:52512451-52512473 TAGCTCTGCCACTTATTGGTTGG - Intronic
907574836 1:55517054-55517076 TGGCTCTGCCACTCACCAGCAGG - Intergenic
908389058 1:63669072-63669094 TGGCTCCGCCACTCACTAGCTGG - Intergenic
910177917 1:84450876-84450898 TAGCTCTGCCACTTACTACCTGG - Intergenic
911725110 1:101235139-101235161 CAGCTCTGCCACTCACTAGCTGG + Intergenic
911881711 1:103247922-103247944 TAGCTCTGCTACTAACTAGCTGG - Intergenic
912699056 1:111862657-111862679 TTACTCTACCAGTTACTAGTTGG + Intronic
913213247 1:116599082-116599104 TGGCTCCACCATTCACTAGGTGG + Intronic
913375622 1:118148674-118148696 CAGCTTCACCTCTCACTAGTTGG + Intronic
917121710 1:171650349-171650371 AAGCTCTACCACTGACCAGCTGG + Intronic
917515240 1:175701619-175701641 TGGCTCAGCCACTCATTAGTGGG - Intronic
917702444 1:177594895-177594917 TGGCTCTGCCACTTACTAGCTGG + Intergenic
918540263 1:185624711-185624733 TAGCTTTACCTCTCACTTTTAGG - Intergenic
919531560 1:198727600-198727622 TAGCTCTACCACTTCTTAGTTGG - Intronic
920068987 1:203289188-203289210 TAGCTCTGCCACTTGCTGGTAGG - Intergenic
920887135 1:209939686-209939708 AAACTCTACCACAAACTAGTTGG - Intronic
920910089 1:210208328-210208350 TGGCTCTACCACTTACTAACAGG + Intergenic
920982504 1:210851453-210851475 TACCTCTGCCATTCACTAGGTGG + Intronic
922557865 1:226546797-226546819 CAGCTCTACCACTGATTAGTGGG + Intergenic
922580783 1:226696142-226696164 TGGCTCTACTAGTCACTAGCTGG + Intronic
924422407 1:243921971-243921993 TAGCTCTACCACTTCCTAGCAGG - Intergenic
1063330799 10:5157421-5157443 TGGCTTTGCCACTTACTAGTTGG - Intergenic
1063670697 10:8097419-8097441 TCGCTCAACCACTAACTAGCTGG - Intergenic
1066227340 10:33396158-33396180 TGGCTCTACTACTAGCTAGTTGG + Intergenic
1067382673 10:45789263-45789285 TTGCTTTACCACCCACTGGTGGG - Exonic
1067890375 10:50129811-50129833 TTGCTTTACCACCCACTGGTGGG - Exonic
1068051309 10:51952401-51952423 GAGCTCTACTACTTACTAGCTGG + Intronic
1068313900 10:55317082-55317104 TAGCTCTACTGCACACTGGTTGG + Intronic
1069626628 10:69871949-69871971 TGGCTCTGCCACTTACTACTTGG - Intronic
1070948489 10:80412251-80412273 TCGCTCTACTGCTCACTAGCAGG - Intronic
1071425299 10:85543446-85543468 TAGCTCTATAACTCACTATTAGG - Intergenic
1072162135 10:92777993-92778015 TGGCTCTACTATTCACTATTTGG + Intergenic
1072711223 10:97716833-97716855 TACCTCTACCACTCATTAGCTGG - Intronic
1073057606 10:100712396-100712418 TGGTTCTACCACTGACTAGCTGG + Intergenic
1073488501 10:103837330-103837352 TAGCTCTACCACTTGCTAGCAGG + Intronic
1074169957 10:110922272-110922294 TAACTATACCAATCACTACTCGG - Intronic
1074264563 10:111888602-111888624 CAGTTCTACCACTCACTGCTGGG - Intergenic
1074314500 10:112349479-112349501 TAGCTCTCCCTCATACTAGTTGG + Intergenic
1074578589 10:114694502-114694524 CTGGTTTACCACTCACTAGTTGG + Intergenic
1075478079 10:122753786-122753808 TGGCTCTACCACATTCTAGTCGG - Intergenic
1075951389 10:126480801-126480823 CACCTGTACCACTCACTAGGTGG + Intronic
1079924846 11:26481185-26481207 TAGCTTTGCCACTCACTATGTGG - Intronic
1080127563 11:28754865-28754887 CAGCTCTGCTACTTACTAGTGGG + Intergenic
1081706893 11:45187540-45187562 TAGCTCCACCAGTCACGAGTAGG + Intronic
1081810841 11:45913402-45913424 TAGCTCTACCACTGGCTAGCTGG + Intronic
1085092305 11:73727558-73727580 TAGTTCTACCATTTAGTAGTTGG - Intronic
1085143894 11:74174856-74174878 TAGCTCTGCTACCTACTAGTTGG - Intronic
1086006316 11:82042380-82042402 CAGCTCTACCACTTTCTAGCTGG + Intergenic
1086262247 11:84954057-84954079 TTGCTCTTCCCCTCACTATTAGG + Intronic
1087802942 11:102523722-102523744 TAGCTCCACTACTTACTAGCTGG + Intronic
1088614137 11:111606147-111606169 TAGCTATACCACTAACTAGAAGG - Intronic
1088811321 11:113394776-113394798 TAGCACTACCACTTACTATCTGG - Intronic
1088943327 11:114483236-114483258 CAGCTCTGCCACTCGCTGGTTGG + Intergenic
1089410075 11:118233627-118233649 CAGTTCTTCCACTCACTAGCTGG + Intronic
1089947139 11:122487671-122487693 CAGCTCTGCCACTTACTAGCTGG - Intergenic
1090353809 11:126125617-126125639 CAGCTCTGCCACTCACCAGCTGG - Intergenic
1091434494 12:461843-461865 TGGCTCTGCCACTAACTAGCGGG + Intronic
1091696152 12:2629615-2629637 TACCTCTGCCACTGACTAGCTGG - Intronic
1092050451 12:5465982-5466004 CAGCTCTACCACTTACAAGTTGG - Intronic
1092658987 12:10718713-10718735 CAGCTCAATGACTCACTAGTTGG + Intronic
1094124001 12:27003576-27003598 GAGCTCTACCATTCACTGGCTGG - Intronic
1094224931 12:28034245-28034267 TAGCTCTACAACTGGCCAGTTGG - Intergenic
1096673267 12:53212939-53212961 TAGCTCTGCCACATAGTAGTGGG - Intronic
1097607815 12:61777643-61777665 TAGCTCTACCACTTATTTGCTGG + Intronic
1098448422 12:70591369-70591391 TAGCTCTACCACTTACTGGCTGG + Intronic
1098833234 12:75389020-75389042 TAGCTCTACCACTCCCTGGCTGG + Intronic
1099111803 12:78571249-78571271 TAGCTCTACCAATTATTAGGTGG + Intergenic
1100757036 12:97762829-97762851 TGGCTCTACCACTTACTGGCAGG - Intergenic
1100939425 12:99709576-99709598 TAGCTATACCACTTGCTAGCTGG - Intronic
1101489034 12:105195072-105195094 TGGCTCTACCACTCACAATGTGG + Intronic
1101669890 12:106859643-106859665 TGGCTCTACCAATTACTAATTGG - Intronic
1102006555 12:109592698-109592720 TGGCTCGGCCACTCACTAGCTGG - Intronic
1102702385 12:114850662-114850684 ATGCTCTACCACTCACTAGCTGG + Intergenic
1102884352 12:116510288-116510310 CATCTCTGCCACTTACTAGTGGG + Intergenic
1103360800 12:120352465-120352487 CAGCTCTGCCACTTCCTAGTTGG + Intronic
1106175712 13:27329452-27329474 TAGCTCTGCCACTTACTTGCTGG + Intergenic
1108582662 13:51840115-51840137 CAGTTCTACCACTTACTAGCTGG - Intergenic
1109714211 13:66200077-66200099 CAGCTCTGCCACTCACAAGCTGG - Intergenic
1112990367 13:105506168-105506190 TGGCTCTACCACTCGCAAATTGG + Intergenic
1114263479 14:21056759-21056781 CAGCTCTGCCACTCACTCGGCGG + Intronic
1116609373 14:47047486-47047508 TAGCTCTATCACCTACTAGCTGG + Intronic
1117501122 14:56352373-56352395 CAGCTCCACCACTAAATAGTTGG - Intergenic
1117802664 14:59461338-59461360 TAGTTCTACCACTAAATAGTTGG + Exonic
1118295142 14:64561527-64561549 TAGCTCTGCCCCTGACTAGATGG + Intronic
1118681140 14:68242838-68242860 AGGCTCTACCACTAACTAGGTGG - Intronic
1119145806 14:72313064-72313086 TAGCTCTGCCCCTTACTAGCTGG + Intronic
1119420302 14:74504148-74504170 CAGCTCTGCCACTTACTAGGTGG + Intronic
1121454209 14:94027926-94027948 CAGCTCCACCACTCCCTGGTGGG - Intronic
1121676265 14:95755493-95755515 CAGGTCTGCCACTCACTAGCTGG - Intergenic
1122014696 14:98784833-98784855 TAGGTCTACCACTTGCTAGTGGG + Intergenic
1126191083 15:45879496-45879518 AAGCTCTACTACTTACTAGCTGG - Intergenic
1126204060 15:46021985-46022007 TAGCTTTTCCACTTACTAGCTGG - Intergenic
1126954957 15:53923225-53923247 TAGCTATACCACTCACCAAAAGG + Intergenic
1127842960 15:62846385-62846407 TTGCTTTGCCACTCACTAGCTGG - Intergenic
1128315733 15:66658084-66658106 TGGCTCTGCCATTCACTTGTTGG - Intronic
1129294105 15:74590324-74590346 CAGCTCTACCACTTACTGGCTGG - Intronic
1129743810 15:78004010-78004032 CAGCTCTACCACTTACTAGCTGG + Intronic
1130211190 15:81924232-81924254 CAGCTCTGCAACTCACTAGCTGG + Intergenic
1130993600 15:88891708-88891730 TAGCTCTGCCACTTCCTAGCTGG - Intronic
1134008992 16:10837295-10837317 TAGCTCTGCCACTTACCAGTGGG - Intergenic
1134031346 16:10994995-10995017 TGCCTCTGCCTCTCACTAGTGGG + Intronic
1134313015 16:13093302-13093324 CATCTCTGCCACTTACTAGTTGG + Intronic
1135056580 16:19237144-19237166 CAGCTCAACCACTCACCAGCTGG - Intronic
1135242003 16:20815707-20815729 CAGCCCTACCACTTACTAGCTGG - Intronic
1135611626 16:23872596-23872618 TGGCTCTGCCACTTCCTAGTTGG + Intronic
1135998276 16:27269465-27269487 TGGCTCTGCCACTTACTAGTTGG + Intronic
1136605251 16:31329598-31329620 TAGCTCTCCCACTTACTCGGTGG - Intronic
1137920118 16:52478695-52478717 CAGCTCTACCACTTACAAGCTGG + Intronic
1138162371 16:54766480-54766502 CAGCTCTGCCACTTACTAGCTGG + Intergenic
1138870234 16:60874442-60874464 TATCTCTAGCACTCACAGGTGGG + Intergenic
1142871723 17:2825545-2825567 TGGCTCTGCCACTCACTGCTGGG + Intronic
1143340579 17:6207827-6207849 CAGCTCTGCCACTCACCAGCTGG - Intergenic
1143676571 17:8436878-8436900 AAGCTAAACCACTCACCAGTTGG - Intronic
1144829782 17:18124750-18124772 TAGCCCCACCACTCACCAGCTGG + Intronic
1145734423 17:27217063-27217085 TGTCTCTGCCACTCACTAGCTGG - Intergenic
1146527524 17:33579563-33579585 GAGCTGTAACACTCACCAGTAGG - Intronic
1147737769 17:42651648-42651670 TAGCTCTCCCAGTCATTAGCAGG - Intergenic
1147991428 17:44336041-44336063 CAGCCCTACCACTCATGAGTTGG + Intergenic
1148139621 17:45318820-45318842 TGGCTCTGCCACTGACTAGCTGG + Intergenic
1149286164 17:55166715-55166737 TTGCTCTACCACTCCTGAGTGGG - Intergenic
1149566943 17:57647016-57647038 TAGCTCTAACAATGACAAGTGGG - Intronic
1155766892 18:29647310-29647332 TAGCTGTACTTCTCACAAGTAGG - Intergenic
1157128100 18:44976684-44976706 CAGCTCTGTCACTCACTAGCTGG + Intronic
1157309833 18:46544205-46544227 TAGCTCTGCCACTTACCACTGGG + Intronic
1158913820 18:62098760-62098782 TAGCTCTACCAATCCCAAGGAGG + Intronic
1159381589 18:67666917-67666939 TAGCTCAACAACTTACTAGCAGG - Intergenic
1161896764 19:7088296-7088318 GTGCTCTACCACTTACTAGCTGG - Intergenic
1164203381 19:23037830-23037852 TAGCTCAACCACTCCCTATATGG - Intergenic
1165308404 19:35016109-35016131 CAGCTCTGCCACTTACTAGCTGG + Intronic
1166591595 19:44003955-44003977 CAGCTCTACCTCTCACTAGTTGG - Intronic
1166601139 19:44095376-44095398 CAGCTCCACCTCTCACTAGTCGG - Intronic
1166856436 19:45784638-45784660 TACCTCTACCACTGACTTGCTGG + Exonic
1168077989 19:53991212-53991234 TTCCTCTACCACTCAGAAGTGGG + Intergenic
925785370 2:7427330-7427352 GAGCATTACCACTCACTAGAAGG + Intergenic
927104731 2:19813336-19813358 CAGCTCTACCTCTCGTTAGTTGG + Intergenic
928205364 2:29279838-29279860 GAGTTCTACCACTTACTAGCTGG + Intronic
928734721 2:34274679-34274701 TAGCTCTGTCACTTACTAGTTGG - Intergenic
929411136 2:41698406-41698428 CTGCTCTATCACTCACTAGCTGG - Intergenic
929425907 2:41844512-41844534 TGGCTCTACCACTCGCTATGTGG - Intergenic
929657745 2:43751003-43751025 TGGCTCTACCACTTACTATGTGG + Intronic
929686122 2:44036420-44036442 TGGCTCTGCCACTTACTAGTTGG - Intergenic
929761274 2:44809366-44809388 TAGTTCTGCCACTTTCTAGTTGG + Intergenic
929942315 2:46343827-46343849 TAGCTCTGCCACTGATTAGCTGG + Intronic
933497478 2:83067749-83067771 TTCCTATACCACTAACTAGTGGG + Intergenic
934064647 2:88329762-88329784 CAAATCTACCATTCACTAGTAGG + Intergenic
934570270 2:95366420-95366442 CAGCTCATCCACTCACCAGTTGG + Intronic
938106091 2:128530713-128530735 TAGCTCTACCACTCCGGATTTGG - Intergenic
938813257 2:134873021-134873043 TGGCTCTACCTTTCACTAGTTGG + Intronic
938927158 2:136054678-136054700 CAGCTCTACCACTTACTAGCTGG - Intergenic
940070043 2:149676712-149676734 TAGCTCTGCCACTTACCAGCTGG - Intergenic
940485713 2:154292596-154292618 TAGCTCTGCAACTTACTAGCTGG - Intronic
941824778 2:169882935-169882957 CAACTCTACCACTAACTAGACGG - Intronic
942787286 2:179714388-179714410 TAGCTCTACCACCTACTTATTGG - Intronic
943329845 2:186545955-186545977 CAGCTCTACCACTTTCTAGTTGG - Intergenic
943647029 2:190417522-190417544 TAGATCGAGCACCCACTAGTAGG - Intronic
944270165 2:197774062-197774084 TAGTGCTACCACTCACCATTAGG + Exonic
944662499 2:201932926-201932948 TAGTTCTTTCACTCTCTAGTGGG + Intergenic
945277853 2:208006448-208006470 TGGCTCAACCACTCACTTGCTGG + Intronic
946113333 2:217439210-217439232 TAGCTCTACCATTTACTAGCTGG + Intronic
947750832 2:232531156-232531178 CAGCTCTGCCACTTACTAGCTGG - Intronic
1169034024 20:2435059-2435081 TACCTCTCCCACTCACAAGCAGG - Intergenic
1170419540 20:16179177-16179199 TAGCTCTACTACTTCCTAGCTGG + Intergenic
1171989895 20:31687942-31687964 TAGCTCTGCCACTTAATAGCTGG + Intronic
1172178228 20:32985380-32985402 TAGCTCTGCCATTGACTTGTAGG + Intronic
1172437941 20:34943187-34943209 TAGCTCTACCACTCACTAGTAGG + Intronic
1172509485 20:35490536-35490558 TCTCTCTACTACTCACTAGTGGG - Intronic
1172606589 20:36218171-36218193 CAGCTCTACCACTAACTTGCTGG + Intronic
1173594565 20:44250269-44250291 CAGCTCTACCACTGACCAGCTGG + Intronic
1174122718 20:48278764-48278786 TAGCTCTACCATTCAGCAGCTGG - Intergenic
1174201496 20:48809427-48809449 TAGCTCTACCACATGGTAGTGGG - Intronic
1175173425 20:57094994-57095016 CAGCTCCACCACTTACTAGATGG + Intergenic
1178639531 21:34334871-34334893 CAGCTCTACCCCTAACTTGTTGG - Intergenic
1179078546 21:38147864-38147886 TGGCTCCAGCACTCACTATTGGG + Intronic
1182321869 22:29482853-29482875 CAGCTCTGCCACTCACTAGCTGG + Intronic
1182414044 22:30209685-30209707 TGACTCTACCACTGACTAGCTGG - Intergenic
1182779634 22:32857553-32857575 TAGCTCCACCACTCACCTGGGGG + Intronic
1182882401 22:33744859-33744881 TGGCTCTGCCACTCACAGGTTGG + Intronic
1183104457 22:35606338-35606360 CAGCTCTGCCACTTACTAGCAGG + Intergenic
1183187117 22:36298546-36298568 TAGCTCTGTCACTGACTAGCTGG - Intronic
1183290468 22:36999018-36999040 CAGCTCAGCCACTCACTAGCTGG - Intronic
1184042719 22:41953466-41953488 TAGCTCTGCCACTTTCCAGTTGG + Intergenic
949777878 3:7652467-7652489 TAGCTCTGCCCCTTTCTAGTGGG + Intronic
950160940 3:10760757-10760779 TAGTTCTGCCACTCGCTGGTTGG + Intergenic
951158276 3:19382323-19382345 TAGCTCTTCCACTGCCTAGTTGG + Intronic
953266458 3:41393903-41393925 CAGCTCTACCATTTCCTAGTTGG + Intronic
954065176 3:48100151-48100173 CAGATCTACCACTTACTGGTTGG - Intergenic
956478685 3:69651149-69651171 TGGCTCTTCCACTTACTAGCTGG - Intergenic
956617136 3:71183667-71183689 TGGCTCTGCCACTTGCTAGTTGG - Intronic
956923483 3:73956205-73956227 TAGTTCTGCCACTAACTGGTCGG + Intergenic
956952326 3:74296697-74296719 TGGCTGTACCACTTACTATTAGG + Intronic
957241148 3:77662786-77662808 TGACTCTACTACTAACTAGTTGG + Intergenic
959530196 3:107427611-107427633 TAGTTCTGCCACTTAATAGTAGG - Intergenic
960916753 3:122702649-122702671 TGGCTCTACCATTTGCTAGTTGG - Intronic
961038469 3:123660165-123660187 TGGCTCTGCCACTGACTACTGGG - Intronic
961405249 3:126673765-126673787 CAGCTCCACTACTCACTAGTTGG + Intergenic
961671619 3:128536166-128536188 AGGCTCTGCCACTTACTAGTTGG - Intergenic
962426620 3:135274416-135274438 CAGCTCTGCCACACACTATTGGG - Intergenic
962840446 3:139227866-139227888 TGGTTCTGCCACTTACTAGTGGG - Intronic
963709715 3:148733120-148733142 TAGCTTTCCCACTCACTGGCTGG - Intronic
965376471 3:167930585-167930607 TAGCTCCAACACTTACTAGCTGG - Intergenic
965856519 3:173095084-173095106 TAGCTTTGCTACTTACTAGTAGG + Intronic
966569306 3:181423376-181423398 CAGCTCTACCACTTACTAGCTGG + Intergenic
967060557 3:185868687-185868709 TAGCTTCATCACTTACTAGTTGG - Intergenic
972543617 4:40059914-40059936 TAACACTCCCACACACTAGTCGG - Intronic
974587002 4:63892426-63892448 TAAATCCACCTCTCACTAGTTGG - Intergenic
974815021 4:66992763-66992785 TAGCTCTATTACTAATTAGTTGG - Intergenic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
978727075 4:111981736-111981758 TAGCTCCACCATTTATTAGTGGG - Intergenic
978944468 4:114478837-114478859 TAGCTCTTCCTCCCACTATTTGG + Intergenic
979008319 4:115333645-115333667 TAGTTCTGCCACAAACTAGTTGG - Intergenic
979061078 4:116060875-116060897 TGGCTTTAACACTAACTAGTTGG + Intergenic
979472218 4:121112224-121112246 TAGCTCTTCTACTTACTATTTGG - Intergenic
982624806 4:157753188-157753210 TAGGTCTACCACTTACTGTTTGG + Intergenic
987018342 5:13844061-13844083 TAGCTCTAACACTCCCTAACTGG + Intronic
988931433 5:36039367-36039389 TACCTGTACCATTCACCAGTGGG + Intronic
989191251 5:38671752-38671774 TACCTCTGCCACTATCTAGTTGG - Intergenic
989305474 5:39950562-39950584 TAGTTTTACCACTCACTAATTGG + Intergenic
990779760 5:59346738-59346760 TGGCACTGCCACTCACTGGTTGG - Intronic
990982514 5:61614854-61614876 CAGCTCTGCCACTCACTGGCTGG - Intergenic
991515710 5:67432752-67432774 TAGCTCTGCCACATACTAGCTGG - Intergenic
992902294 5:81309704-81309726 CAGCACTGCCACTCACTAGCTGG + Intronic
994146975 5:96406230-96406252 TAGCTCTACCACTAGCTATGTGG - Intronic
994148270 5:96419558-96419580 TAGATCTGCCACTTAGTAGTTGG - Intronic
998300412 5:141013322-141013344 TAGCTGTGCCACTAACTAGATGG + Intergenic
999580389 5:153031930-153031952 TAACTCTACCACTTACTAGCTGG - Intergenic
999816576 5:155183068-155183090 TAGCTCTACCTCTCATGAGCCGG - Intergenic
999870718 5:155747600-155747622 TAGCTCTACCACTTTGTAGCTGG - Intergenic
1003178095 6:3768798-3768820 TGTCTCTAACACTCACTAGGTGG + Intergenic
1006885854 6:37381651-37381673 TTGCTGTACCAGTCACTAGATGG + Intronic
1008449971 6:51639507-51639529 TAGCTCTATCAGTCATTATTTGG - Intronic
1009942978 6:70310649-70310671 CAGCTCTACCACTTTCTAGCTGG + Intergenic
1013652467 6:112209581-112209603 TAGCTCTTCCACTTTCTAGCTGG + Intronic
1015236248 6:130974618-130974640 TGGCTCTACCACTCATAAGTGGG - Intronic
1017410219 6:154160245-154160267 TAGCTCTTCCACTAACTCTTGGG - Intronic
1017588899 6:155957176-155957198 AAGTTCTACCACTAACTAATGGG + Intergenic
1018453413 6:163930173-163930195 TAGCTCTGCCACTTAATAGCTGG - Intergenic
1022017653 7:26365834-26365856 TCGCTCTGCCACTTACTAGCTGG + Intronic
1026523484 7:71135485-71135507 CAGCTCTGACACTCACTAGCTGG - Intronic
1027477714 7:78654184-78654206 TGGCTCTATCACTTACTAGCTGG + Intronic
1028891961 7:95998207-95998229 TGGCTCTACTGCTCACTAGCTGG - Intronic
1029527724 7:101105203-101105225 CAGCTCCACCACTCACTAACTGG + Intergenic
1033270057 7:139922741-139922763 TGGTTCTACCTCTCACTATTGGG + Intronic
1037800357 8:22031146-22031168 TAGCTGTACCTCTCACTTATGGG - Intronic
1038047396 8:23777253-23777275 CAGCTCTGCCACTCATGAGTGGG + Intergenic
1041408884 8:57531875-57531897 TAGCTCCACCACTCACTAGCTGG + Intergenic
1041460389 8:58105232-58105254 CAGCTCTACCACTCAATATCAGG + Intronic
1044300916 8:90581928-90581950 CAGCTCTGCCACTCACCAGCTGG + Intergenic
1044305092 8:90630471-90630493 TGGCTCTACCACTTATTAGTCGG + Intronic
1044612011 8:94100919-94100941 CAGCTCCACCACTTACTAGCTGG - Intergenic
1044952463 8:97447643-97447665 CCGCTCTACCACTAACCAGTGGG + Intergenic
1046740274 8:117820279-117820301 CAGATCTACCACTTACTGGTCGG + Intronic
1046860775 8:119088970-119088992 CAGCTCCACCACTCACTATCTGG - Intronic
1047017678 8:120740972-120740994 TTGCTCAACCACTGACTAGCTGG - Intronic
1047471711 8:125180642-125180664 TAGCATTACCTCTGACTAGTTGG + Intronic
1048235805 8:132689149-132689171 TTGCTCTACAACTCATCAGTTGG - Intronic
1048338937 8:133524295-133524317 TGGCTCTACCACTTTCTAGCTGG - Intronic
1048795137 8:138142719-138142741 TTGTTCTAACACTCACAAGTTGG - Intronic
1048806828 8:138248939-138248961 TAGCCCTACCACTTACTTTTTGG - Intronic
1052194409 9:25693938-25693960 TAGATCTCCCACACATTAGTAGG - Intergenic
1052990481 9:34516547-34516569 TGGCTCTGCCACTTACTAGCAGG + Intronic
1057602913 9:96473906-96473928 CAGCTCTGCCACTTACTAGTTGG + Intronic
1058774547 9:108270839-108270861 TGGCTCCAACACTCACCAGTTGG + Intergenic
1059395917 9:114033990-114034012 CAGCTCCACCACTTACTAGCTGG + Intronic
1059543359 9:115152650-115152672 TGACTCCACCACTTACTAGTTGG - Intronic
1059721235 9:116962021-116962043 TAGCTCTGCCATTCACTATGCGG - Intronic
1060233508 9:121842868-121842890 TGGCTCTACCACTCACGAGCTGG + Intronic
1060416338 9:123433240-123433262 CAGCTGTGCCACTCACTAGCTGG - Intronic
1060487330 9:124056342-124056364 TGGATCTACCACTTACTAGGTGG - Intergenic
1060689859 9:125648188-125648210 CAGCTCTGCCACACACTAGTGGG + Intronic
1061930739 9:133831855-133831877 TGGCTCTGCCACTTACTAGCTGG + Intronic
1186776345 X:12868482-12868504 TGGCTCTCCCAGTCACTAGTTGG + Intronic
1186840187 X:13477710-13477732 CAGCTCTACCACTCACTGGCTGG - Intergenic
1187099312 X:16176208-16176230 TTGGTCTACCACTTACTAGCTGG + Intergenic
1187660524 X:21541818-21541840 TAGCTCTATCACTTACTAGTTGG - Intronic
1187750080 X:22453323-22453345 TATCTCTAGCATTTACTAGTGGG - Intergenic
1188515693 X:30983148-30983170 TGGCTCTGCTACTCACTAGCTGG - Intergenic
1189248965 X:39585282-39585304 TAGCTCCACCATTTACTAGCTGG + Intergenic
1189627650 X:42916310-42916332 TGGCTCTTCTACTCACTAGCTGG + Intergenic
1189999030 X:46667233-46667255 TAGCCCTACCAATCACTGATCGG - Intronic
1190151879 X:47956180-47956202 TACCTCTTCCACTCTCTAGCGGG - Intronic
1190160822 X:48030283-48030305 TACCTCTTCCACTCTCCAGTGGG + Intronic
1190329222 X:49225565-49225587 TGGCTCTGCCACTCGCTAGCTGG + Intronic
1190649364 X:52554432-52554454 TGGCTCCACCACTCACTGCTGGG - Intergenic
1190759670 X:53428874-53428896 TGGCTCTGCCACTTACTAGCTGG + Intronic
1192226249 X:69230073-69230095 TAACTCTACCACTTACTAGCTGG - Intergenic
1193630475 X:83880543-83880565 TTGCTCTATCACTTACTAGCAGG + Intronic
1195021043 X:100828970-100828992 TAGCTCTGCCACTTACTAGTTGG - Intronic
1196689508 X:118544327-118544349 TATTTCTACCACTTACTAGCTGG + Intronic
1198029781 X:132743671-132743693 TGGCTCTACCACTTCCTAGCTGG - Intronic
1198127103 X:133656408-133656430 TAGCTCTACCACTTACTGTATGG + Intronic
1200888351 Y:8295884-8295906 TGGCTTCACCTCTCACTAGTAGG + Intergenic