ID: 1172439013

View in Genome Browser
Species Human (GRCh38)
Location 20:34952336-34952358
Sequence GGCTGAACATTCTGGGGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172439004_1172439013 24 Left 1172439004 20:34952289-34952311 CCCTAACTGTGAAACAAGAAGAA 0: 1
1: 0
2: 0
3: 51
4: 548
Right 1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 213
1172439005_1172439013 23 Left 1172439005 20:34952290-34952312 CCTAACTGTGAAACAAGAAGAAT 0: 1
1: 0
2: 3
3: 30
4: 476
Right 1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG 0: 1
1: 0
2: 0
3: 31
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172439013 Original CRISPR GGCTGAACATTCTGGGGAGC TGG Intronic
900183067 1:1320859-1320881 GGCTGCACCCTGTGGGGAGCAGG - Intronic
902556036 1:17247351-17247373 AGCTGGAGATGCTGGGGAGCGGG + Intergenic
902644904 1:17791240-17791262 GGCTGTACACTCCGTGGAGCTGG - Intronic
903069938 1:20722074-20722096 GCCTGCACATTTTGGAGAGCAGG + Intronic
904033043 1:27545039-27545061 GGAAGAACATTCTGGGCAGAGGG - Intronic
905933878 1:41808303-41808325 AACTGGACCTTCTGGGGAGCAGG - Intronic
906286394 1:44590577-44590599 GGGCAAACATTCTGGGGAGCGGG - Intronic
907369783 1:53993188-53993210 GGCTGCACACTCTGTGAAGCCGG - Intergenic
907603521 1:55793800-55793822 GGATGCACACTCTGTGGAGCTGG + Intergenic
910065149 1:83143209-83143231 AGCTGAACATTCCGGTTAGCAGG - Intergenic
910518801 1:88093919-88093941 AATTGAACATTCTGGGGACCTGG - Intergenic
910768792 1:90809933-90809955 GGCTGAACATTATATGGAGAAGG - Intergenic
911379578 1:97095876-97095898 GTATGGACATTCTGGGGAGAAGG + Intronic
914953218 1:152137471-152137493 GGCAGAACATTCCAGGGAGAAGG - Intergenic
916077412 1:161209944-161209966 GGCTGGACATTTGGGGAAGCCGG - Intronic
916440260 1:164817987-164818009 AACTGAACACTCTGGGGAGTTGG + Intronic
916562311 1:165943623-165943645 GGGTGAAGATTCTGGGAAGTTGG + Intergenic
916818587 1:168376318-168376340 GACTGATCAGTGTGGGGAGCAGG + Intergenic
919794107 1:201310855-201310877 GGCTGCACCTGCAGGGGAGCGGG - Intronic
923127156 1:231041909-231041931 GGCGGAAAATTCTGGGCAGTGGG - Intergenic
1063825935 10:9897390-9897412 GGCTGAACATGCTGGTGTACTGG + Intergenic
1065552970 10:26887704-26887726 GCATGAACATTGTGGGGAGGAGG - Intergenic
1066484750 10:35832528-35832550 GGCTGGGCATTCTAGAGAGCAGG + Intergenic
1067305351 10:45059081-45059103 GGCTGCGCATTCTAGAGAGCAGG + Intergenic
1067922380 10:50472922-50472944 GGATTAACAGTGTGGGGAGCAGG - Intronic
1068326558 10:55496054-55496076 GGCTGAATATTTTGGGGAGGAGG + Intronic
1069858477 10:71455232-71455254 ATGTGAACATTATGGGGAGCTGG - Intronic
1069863087 10:71483314-71483336 GGTTGAACTTTTTGGGGAGCAGG + Intronic
1070034849 10:72712162-72712184 TGCTGAATATTCTGGGGGACAGG + Intronic
1070100107 10:73377724-73377746 ACCTCAACATTCTGGGTAGCTGG + Intronic
1070648398 10:78217657-78217679 GGCTGAGCATGCAGGGGACCCGG + Intergenic
1074928059 10:118093754-118093776 GGCTGAAGATTCTGAGAAGCTGG + Intergenic
1076361118 10:129889516-129889538 GGCTGCAGAGTTTGGGGAGCAGG - Intronic
1076701926 10:132277708-132277730 GGCAAAGCATTGTGGGGAGCAGG + Intronic
1077173717 11:1179502-1179524 GGTAGAACATTCTGGGCAGAGGG + Intronic
1077453438 11:2664324-2664346 GGCTGAGGCTTCAGGGGAGCTGG + Intronic
1077476686 11:2793806-2793828 GGCTGTACATTCTAAGGAGCAGG - Intronic
1077664889 11:4098981-4099003 GCCTGAACATTCTCGGCAGAGGG + Intronic
1078191530 11:9095493-9095515 TGCTGAGCAGTATGGGGAGCTGG + Intronic
1078486631 11:11729264-11729286 GGCTAATCATTCTGGGGAGGAGG - Intergenic
1078912509 11:15746174-15746196 GGCTGAAGTTTTTGGGGAGAGGG + Intergenic
1084601339 11:70147579-70147601 GGCTGAACCTACTGGGAAGAGGG - Intronic
1085190409 11:74615695-74615717 GGTTGAAAATCCTGGGGAGGTGG + Intronic
1089479119 11:118791071-118791093 GGCTGGACAGCCGGGGGAGCCGG - Intronic
1090529782 11:127578632-127578654 GGCTGGATTTTCTGGGAAGCAGG + Intergenic
1090748241 11:129724022-129724044 GGCTGGAGATTCTGGGCAGGAGG - Intergenic
1092922416 12:13244544-13244566 GGCTGATCATCCTGGGGAAAGGG + Intergenic
1093183165 12:15989210-15989232 GGCTGCACACTCCGTGGAGCTGG - Intronic
1096159099 12:49361853-49361875 GTCTGAACATTGTGTGGTGCAGG - Intergenic
1096649350 12:53054258-53054280 GGCTGAAGCTCCTGGGGAGGAGG - Exonic
1097633191 12:62089336-62089358 GCCTGAAAATTATGGGTAGCAGG - Intronic
1097980834 12:65736699-65736721 TGCTTAACATTTTAGGGAGCAGG + Intergenic
1100182580 12:92101170-92101192 GCCTGAACATTATGAGGAGGAGG + Intronic
1100388346 12:94124244-94124266 GGCTGAACATTCTCTGGAGATGG + Intergenic
1101737827 12:107476165-107476187 GGCTGAACAGCCTAGGTAGCCGG - Intronic
1101860758 12:108480609-108480631 GGCTGAAAAATCTAGGGTGCTGG - Intergenic
1102889840 12:116549984-116550006 TGTTGAACATTGAGGGGAGCCGG - Intergenic
1103314037 12:120037426-120037448 GCCTGAAAATTCTCGGGAGCAGG - Intronic
1103557569 12:121775527-121775549 TGCTGGAGATTCTGGGGTGCTGG + Intronic
1105424324 13:20282283-20282305 GGCTGCACACTCTATGGAGCTGG + Intergenic
1110730927 13:78877453-78877475 AGCTGTGCATTCTGTGGAGCTGG - Intergenic
1110920516 13:81078195-81078217 GCCTGAACATGCTGGCAAGCTGG - Intergenic
1113284904 13:108836162-108836184 GGCTGAAGTTGCTGGGGTGCAGG - Intronic
1114948829 14:27720612-27720634 GGCAGAAGATGATGGGGAGCTGG - Intergenic
1115310712 14:31975213-31975235 GGCTGTACACTCTGTGGAGCCGG - Intergenic
1115327248 14:32153815-32153837 GGCTCAACACTTTGGGGAGCTGG + Intronic
1116605484 14:46987910-46987932 GACTGAATATTCTGGGGTGGGGG + Intronic
1119307348 14:73618313-73618335 GGCAGAGAATTCTGGGGTGCCGG - Intronic
1120813125 14:88825039-88825061 GGCTGAAAATTGTGAGGAGGGGG - Intronic
1122130113 14:99600053-99600075 TGCTGTCCTTTCTGGGGAGCTGG - Intronic
1123031093 14:105451446-105451468 GGCTCAGCCTTCTGGGAAGCTGG - Intronic
1124837851 15:33212819-33212841 GGCTTATAATTCTGGGTAGCTGG - Intergenic
1125501071 15:40240656-40240678 GGCTGCTCCTTCTGGGCAGCGGG - Exonic
1125506292 15:40269698-40269720 GGCTGGGGAGTCTGGGGAGCTGG - Intronic
1125968492 15:43893382-43893404 TGTTGAACATAGTGGGGAGCGGG + Intronic
1128473300 15:67974855-67974877 TGCTCCACATTCTGGGGACCCGG - Intergenic
1128661086 15:69501573-69501595 GGCTTAACATTGTGGGCATCAGG + Intergenic
1128672170 15:69581880-69581902 GGCAGAAGATTTTGGGGTGCAGG + Intergenic
1129595737 15:76962737-76962759 GGAGGAACATTCTTGGGAGAGGG - Intergenic
1129741095 15:77989995-77990017 GGCTGAGCACTGGGGGGAGCAGG - Intronic
1129796628 15:78382346-78382368 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132305202 15:100807230-100807252 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1132336191 15:101050135-101050157 GGCTGAAATTGCAGGGGAGCCGG + Intronic
1132338953 15:101066016-101066038 GGAAGAACTTGCTGGGGAGCTGG - Exonic
1202958949 15_KI270727v1_random:103602-103624 GGCTGAGCAGGGTGGGGAGCAGG + Intergenic
1132666114 16:1082073-1082095 GGCTGGACAAGGTGGGGAGCAGG - Intergenic
1134078575 16:11309157-11309179 GGCTGCACATTCTCTGGAGGTGG - Intronic
1134632831 16:15769199-15769221 GGCTGAGCCTCCTGGGTAGCTGG - Intronic
1134683081 16:16140094-16140116 GGAAGAACATTCTAGGCAGCCGG + Intronic
1136091481 16:27923310-27923332 GGATGATCCTCCTGGGGAGCAGG - Intronic
1136525208 16:30825267-30825289 GAATGAACATCCTGGGGTGCAGG - Intergenic
1138471352 16:57240284-57240306 GGCTGTACATGTTGGGGTGCTGG + Intronic
1140833331 16:78771015-78771037 GGCAGAACATTCTAGGCAGAAGG + Intronic
1145725181 17:27114265-27114287 GCCTCAGCATCCTGGGGAGCTGG - Intergenic
1146724673 17:35147682-35147704 GACTGACCAGTCTGGGGAGGGGG + Intergenic
1146842568 17:36166141-36166163 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146854880 17:36254100-36254122 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146865740 17:36334276-36334298 GGCTGAACACCCTGCGGAGCGGG + Exonic
1146870780 17:36377992-36378014 GGCTGAACACCCTGCGGAGCGGG - Exonic
1146878139 17:36429073-36429095 GCCTGAACACCCTGCGGAGCGGG - Exonic
1146882088 17:36450220-36450242 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1147068610 17:37934888-37934910 GGCTGAACACCCTGCGGAGCGGG + Exonic
1147073664 17:37978616-37978638 GGCTGAACACCCTGCGGAGCGGG - Intronic
1147080132 17:38014425-38014447 GGCTGAACACCCTGCGGAGCGGG + Intronic
1147085185 17:38058154-38058176 GGCTGAACACCCTGCGGAGCGGG - Exonic
1147096081 17:38138385-38138407 GGCTGAACACCCTGCGGAGCGGG + Intergenic
1147101131 17:38182120-38182142 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1149123756 17:53202690-53202712 GGATGAACATTCTGGGATGAAGG + Intergenic
1149330701 17:55577960-55577982 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1149845730 17:60008626-60008648 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1150084078 17:62265206-62265228 GGCTGAACACCCTGCGGAGCGGG - Intergenic
1152793458 17:82294077-82294099 TGCTGCACATTCTGGGGACTGGG + Intergenic
1156600824 18:38604043-38604065 GGCTGAAGGATCTGGGGAGGAGG + Intergenic
1156950415 18:42889982-42890004 GGCTGAACATTTGGAGGAGATGG - Intronic
1159005160 18:63004591-63004613 TGCTGAAGATACTTGGGAGCTGG + Intergenic
1161577539 19:5062893-5062915 GCCTCAGCATTCTGAGGAGCTGG + Intronic
1162473583 19:10886932-10886954 GCCTCAGCATTCTGAGGAGCTGG + Intronic
1163581757 19:18143702-18143724 GGCTGAGTATCCTGGGGTGCAGG + Intronic
1168049047 19:53815092-53815114 TACTGAACATTCTGGGGTGCGGG - Intronic
1168088295 19:54064449-54064471 AGGTTAACATTGTGGGGAGCTGG - Intergenic
925646922 2:6045095-6045117 GGCTTCACTTGCTGGGGAGCAGG - Intergenic
932414079 2:71563439-71563461 AGCTGCACACTCTGGAGAGCAGG - Intronic
933460871 2:82583599-82583621 GGCTGGAAATTCAGGGCAGCAGG - Intergenic
934682549 2:96295479-96295501 GGCTCATCATTCTGGTGAGTTGG - Exonic
934768359 2:96893231-96893253 GGCTCAGCTTCCTGGGGAGCAGG - Intronic
934813478 2:97304517-97304539 GCATGAACATTGTGGGGAGGTGG - Intergenic
934824218 2:97403963-97403985 GCATGAACATTGTGGGGAGGTGG + Intergenic
935426770 2:102927770-102927792 GGCTGTCCATCCTGGGGACCTGG - Intergenic
935733506 2:106086196-106086218 GTCTGAGCATGCTGGGCAGCTGG - Intergenic
937710947 2:124979219-124979241 GGCAGAGGATTCTGGGGACCAGG + Intergenic
938261163 2:129895946-129895968 GGGTGGACAATCTGGGGAACAGG + Intergenic
938711315 2:133978274-133978296 GGCTGTACCTACTGGGAAGCAGG + Intergenic
939468241 2:142585639-142585661 GAATGAACGTTCTGGGGTGCAGG + Intergenic
939636446 2:144588696-144588718 GCCTGAAGATTCTTGTGAGCTGG + Intergenic
940677872 2:156746872-156746894 GGGTGGATATTCTGGGAAGCAGG - Intergenic
941808981 2:169737024-169737046 GGCAGAACAGTCTTGGGATCAGG + Intronic
942456396 2:176141052-176141074 GGCTGTCCATTCTGGGTACCAGG - Intergenic
944418654 2:199504895-199504917 GGCTGAACCATCTTGGAAGCAGG + Intergenic
944481655 2:200163564-200163586 GGGTGAACATTCTGTAAAGCAGG - Intergenic
945330246 2:208530490-208530512 GGCTGCACACTCTGTGGAGCCGG - Intronic
945905947 2:215593499-215593521 GCCTCAACCTTCTGAGGAGCTGG - Intergenic
946765123 2:223033400-223033422 GGGTGAACAGTTTGGGGACCAGG + Intergenic
947636888 2:231684757-231684779 GGCTGAGCTTCATGGGGAGCAGG + Intergenic
947886480 2:233576191-233576213 GACTTAACATTCTGGGGTGGAGG + Intergenic
948270174 2:236668016-236668038 GACAGAACATTTTTGGGAGCTGG + Intergenic
1169633194 20:7656987-7657009 GGAAGAACATTCTAGGGAGAGGG + Intergenic
1172193866 20:33078587-33078609 GACGGAACATTCTGGGGTGGTGG + Intergenic
1172439013 20:34952336-34952358 GGCTGAACATTCTGGGGAGCTGG + Intronic
1173473854 20:43344691-43344713 GGCTGGAAATGGTGGGGAGCAGG - Intergenic
1174614239 20:51823682-51823704 GGGAGAAGATTCTGAGGAGCTGG + Intergenic
1175483286 20:59326699-59326721 GGCTGAGGATTCTAGGGAGAGGG + Intergenic
1175829594 20:61954874-61954896 GGCTGGTCATTGTGGGGAGCTGG - Intronic
1176085232 20:63292834-63292856 GGCTGCCCACTGTGGGGAGCAGG - Intergenic
1176104348 20:63378848-63378870 AGCTGCTCATCCTGGGGAGCAGG - Intergenic
1179000412 21:37452474-37452496 GTCTGCACAGGCTGGGGAGCAGG - Intronic
1179436613 21:41366682-41366704 GGCTGAACAATATGGGGCGGAGG - Intronic
1179657416 21:42853815-42853837 GGCTGCACCGTCTGGGGTGCTGG - Intronic
1182028451 22:27138389-27138411 GGCAGATGATTCTCGGGAGCGGG + Intergenic
1182052883 22:27326473-27326495 CTCTGAACATTCTGGTGACCAGG + Intergenic
1182128683 22:27834941-27834963 GGCTGACCACTGTGGGAAGCGGG + Intergenic
1182721956 22:32410214-32410236 GCCTCAACAGTCTAGGGAGCTGG + Intronic
1182861273 22:33561496-33561518 AACAGAACATTCAGGGGAGCTGG - Intronic
1183573078 22:38668879-38668901 AGCTGGGCATTCTGTGGAGCAGG + Intronic
1184230803 22:43157375-43157397 GGATGGACATTCTGGGGGGGTGG - Intronic
1184831724 22:46993016-46993038 GGCTGGACTTTGTGGGGAGGTGG + Intronic
953199863 3:40769074-40769096 GGTTGAACTTTCTGGGCACCTGG - Intergenic
953610428 3:44443173-44443195 GGCAGAACACTCTGGGGGGCTGG + Exonic
954692035 3:52400787-52400809 GGGTGCACTTTCTGGGGAGAGGG - Intergenic
955366686 3:58316339-58316361 GGCAGAACATTCTAGGCAGGGGG + Intronic
956990136 3:74752471-74752493 GGCTACACATTCTGTGGAGTCGG - Intergenic
957539031 3:81544869-81544891 GGCTGAACATTTTGATTAGCAGG + Intronic
958799691 3:98741446-98741468 GGGAGAACATTCCGGGCAGCAGG + Intronic
959699363 3:109283929-109283951 AGCTGAGCCTACTGGGGAGCTGG - Intergenic
960136266 3:114108543-114108565 TGCTGAACATTCTGTAGAACAGG - Intergenic
960690441 3:120341714-120341736 GGCTGCACATTCCATGGAGCTGG + Intronic
961494005 3:127277347-127277369 GGCTGACTATTTTGGGGAGAGGG - Intergenic
961638194 3:128347358-128347380 GGCTAATCTTTCTGGGGAGAGGG + Intronic
962637502 3:137346151-137346173 GACTGAACATTATGGGCAGTGGG - Intergenic
962825363 3:139095971-139095993 GGCTGGACATGTTGGGGGGCTGG - Intronic
964802246 3:160568834-160568856 TGCTGAGCATCGTGGGGAGCTGG + Intergenic
969550669 4:7864604-7864626 GGCTAAACATTCAGGGCAACAGG + Intronic
970462404 4:16288136-16288158 GGATCAACACTCTGGGGAGTGGG + Intergenic
972931194 4:44072742-44072764 GGCTACACATTCTGTGGAGCTGG - Intergenic
975836908 4:78432680-78432702 GGCTGAATATTTGGGGCAGCAGG + Intronic
977767321 4:100814886-100814908 GGCTGAGCATTATGTGTAGCTGG - Intronic
979716688 4:123847920-123847942 GCCTCAACCTTCTGAGGAGCTGG + Intergenic
980877942 4:138680762-138680784 GGCTGATCATTTTGTGGAGCTGG - Intergenic
981034562 4:140156168-140156190 GGCTGAGCCTCCTGGGTAGCTGG + Intergenic
981538508 4:145824671-145824693 GGCTGAACCTTCTGGAAGGCAGG + Intronic
982561350 4:156931648-156931670 GCTTGAACATTCTAGGGAGTAGG - Intronic
983914937 4:173281836-173281858 GGCTCCACATTCTGTGGAGGAGG - Intronic
985806956 5:2052879-2052901 GGGGCAGCATTCTGGGGAGCCGG + Intergenic
985916023 5:2919792-2919814 GGCTGCATACTCTGTGGAGCTGG + Intergenic
987912332 5:24164095-24164117 GCCTCAACATTCTGAGTAGCTGG + Intronic
991171490 5:63631179-63631201 GGATGAAGATTCAGGGGAGATGG + Intergenic
991977365 5:72196391-72196413 GGCTGAACAATCTGAAGAGGAGG + Exonic
993581069 5:89661546-89661568 GGCAGAAAATTTTGGGGACCGGG + Intergenic
995823025 5:116259576-116259598 GGCTGAACAGTCTTGGTGGCTGG + Intronic
996366035 5:122702397-122702419 GTCTCAGCCTTCTGGGGAGCTGG - Intergenic
997361022 5:133294967-133294989 AGCTGAACATGCTGGGGAAACGG + Intronic
998353426 5:141515611-141515633 AACTGGACATTCTGGGGAACTGG - Exonic
1001196418 5:169677157-169677179 GGTTGAGCATTCAGGGGAGCTGG + Intronic
1005744894 6:28827339-28827361 GGCAGGACATTCTGGACAGCTGG + Intergenic
1010198759 6:73264544-73264566 GGTTTAAGATTCTGTGGAGCAGG + Intronic
1011174803 6:84548560-84548582 GCCTGAACTTTCTGAGTAGCTGG + Intergenic
1017562095 6:155639132-155639154 GGCTGGACACTCTGGGATGCTGG + Intergenic
1018609177 6:165630231-165630253 GCCTGAACCTCCTGGGTAGCTGG - Intronic
1018660042 6:166077156-166077178 GGCTGCACACTCTGTAGAGCTGG - Intergenic
1021172573 7:17415431-17415453 GGAGGAACAGTCTGGGGAGGAGG - Intergenic
1022524626 7:31029046-31029068 GGCTGAGTGTTCTGGGAAGCAGG - Intergenic
1026411594 7:70128533-70128555 GGAAGAACATTCTGGGCAACAGG + Intronic
1031209345 7:118802567-118802589 GCCTGAGCATTCTGTGTAGCAGG - Intergenic
1032462852 7:132124773-132124795 GGCTGAAAATCCTGGGTTGCGGG - Exonic
1035259610 7:157653105-157653127 GGCTGCACCGTCTGGGGGGCAGG - Intronic
1038778745 8:30553198-30553220 GGCTGCCGATTCTGGGGGGCAGG + Intronic
1039175046 8:34794004-34794026 GGCTCAACCTTCTGAGTAGCTGG - Intergenic
1039210264 8:35205080-35205102 GGCTGAACACTCCCAGGAGCTGG - Intergenic
1039449341 8:37659099-37659121 GGCTGAACCTCCTGAGTAGCTGG - Intergenic
1040426653 8:47294527-47294549 TGCTGAACCTTCTAGGGAGAGGG - Intronic
1041357430 8:57014854-57014876 GGCTGCACACTCCGTGGAGCTGG - Intergenic
1041791297 8:61698979-61699001 GGCAGAACATTCCTGGGATCTGG - Intronic
1043418722 8:80077400-80077422 GGCTGAACATTATGAGGACCAGG - Intronic
1044097766 8:88089335-88089357 GGCTGAAGATTATGGTGAACAGG + Intronic
1044973026 8:97638330-97638352 GACTGATCATCCTGGGGAGGAGG - Intergenic
1045375486 8:101569582-101569604 GCCTCAACTTTCTGGGTAGCTGG + Intronic
1050130360 9:2406337-2406359 GGCTGCACACTCCGTGGAGCTGG + Intergenic
1051747483 9:20308730-20308752 GGCAGAACATTCTGGACAGAGGG + Intergenic
1052325520 9:27213412-27213434 GGCTGAAAACTTTGGGGAACAGG - Intronic
1052437017 9:28443354-28443376 GGCTGCACACTCTGTTGAGCTGG + Intronic
1056074774 9:83027182-83027204 TGATGAACATACTGAGGAGCTGG - Intronic
1057553890 9:96072377-96072399 GGCTGATGTTTCTGGTGAGCTGG - Intergenic
1058264056 9:102875185-102875207 GGCTGATAATTTTGGGAAGCGGG + Intergenic
1060680687 9:125560810-125560832 GTCTGGACATTCTAGGGAGTGGG - Intronic
1062654275 9:137594355-137594377 GGCAGAACATTCTTGGCAGAAGG + Intergenic
1203790893 EBV:151028-151050 GGCTGACCAGGCTGGGGTGCCGG - Intergenic
1185582081 X:1217419-1217441 GCCTCAACCTCCTGGGGAGCTGG - Intergenic
1187200991 X:17133615-17133637 GGTTGAACAATCTGGGAAGGAGG + Intronic
1188734458 X:33695645-33695667 GGCTGTAGTTTCTGGGTAGCTGG - Intergenic
1189083453 X:37997218-37997240 GGCTGCACACTTTGTGGAGCTGG + Intronic
1193779250 X:85682946-85682968 TGCTGCAGATTCTGGTGAGCAGG + Intergenic
1195692480 X:107638680-107638702 GGCTCAGCACTTTGGGGAGCAGG - Intronic
1196438484 X:115695535-115695557 GGCAGGACATTCTGAGGAGTTGG + Intergenic
1196883846 X:120224176-120224198 GGCTGCACATTCCATGGAGCTGG - Intergenic
1198622206 X:138525844-138525866 TGTTGAACATTCAGTGGAGCCGG + Intergenic
1199861238 X:151801776-151801798 GGCTGCACACTGTGTGGAGCTGG - Intergenic