ID: 1172439345

View in Genome Browser
Species Human (GRCh38)
Location 20:34954785-34954807
Sequence CAGAGAAGAAGCAGATTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 379}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172439345_1172439347 -7 Left 1172439345 20:34954785-34954807 CCCACAAATCTGCTTCTTCTCTG 0: 1
1: 0
2: 2
3: 33
4: 379
Right 1172439347 20:34954801-34954823 TTCTCTGATGAACCCCACCCAGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172439345 Original CRISPR CAGAGAAGAAGCAGATTTGT GGG (reversed) Intronic
903856292 1:26339396-26339418 CAGAGAAGAGGCTGATTTCCGGG + Exonic
903858602 1:26351966-26351988 CAGACCAGAAGTGGATTTGTTGG + Intronic
905142714 1:35861012-35861034 CAGAGGAGAAGCAGATTTTTAGG + Intergenic
905258636 1:36701849-36701871 CAGAGAAGAAACACATTTCAGGG - Intergenic
905851531 1:41278463-41278485 CAGAGAAGGGGCAGTTTTGTTGG + Intergenic
905998207 1:42400642-42400664 GAGGAAAGAAGCTGATTTGTGGG + Intronic
906276352 1:44519088-44519110 GAGAGGAAGAGCAGATTTGTTGG + Intronic
906732778 1:48097591-48097613 CTGAGGAGAAGCAGATTGGAGGG - Intergenic
907283023 1:53363138-53363160 CAGAGGAGAAGCAGGTTTGCGGG - Intergenic
907957087 1:59240019-59240041 CAGAAAAAAAGGATATTTGTGGG + Intergenic
908149024 1:61280656-61280678 CACAGAAAAAGCAGACTAGTTGG - Intronic
911216980 1:95205410-95205432 TAAAGAAGAAGCAGGTTTGAAGG + Intronic
911460254 1:98180768-98180790 CAGAGAAGTAGCAAGGTTGTGGG - Intergenic
911552677 1:99303329-99303351 GACAGATGAAGCAGATTTGTGGG + Intronic
911879073 1:103210258-103210280 AAGACAAGAAGTAGATTAGTGGG - Intergenic
911977985 1:104526357-104526379 CATAGTAAAGGCAGATTTGTAGG - Intergenic
913012250 1:114695590-114695612 CAGAGAAGAATCAAATTTCCGGG - Intronic
913029878 1:114891096-114891118 CAAAGAAGAATGAGAGTTGTTGG - Intronic
913167831 1:116205242-116205264 CAGTCAAGAAACAGATATGTTGG + Intergenic
913421235 1:118671980-118672002 CAGTGATGATACAGATTTGTTGG - Intergenic
913712394 1:121498412-121498434 CAAAGAATATGCAGATTTGAAGG - Intergenic
915675045 1:157521760-157521782 CCCACTAGAAGCAGATTTGTTGG - Intronic
916064198 1:161123032-161123054 CAGAGATGGAGCAGACTTGAAGG - Intronic
916691162 1:167191102-167191124 TACAGAAGAAGGAGATTTATTGG - Intergenic
917035026 1:170739194-170739216 CAAACAAGATGCTGATTTGTAGG + Exonic
919401619 1:197125514-197125536 CAGAGAGGAAGCACATTTATTGG + Intronic
920884420 1:209912751-209912773 CTTAGAAGAAGGAGATTAGTGGG - Intergenic
922987616 1:229878151-229878173 GAGAGAAGAGGGAGATTTTTAGG + Intergenic
923526387 1:234776015-234776037 CTGATAAGAATCAGATTTCTAGG - Intergenic
923650626 1:235869847-235869869 CAGTAAAGAAGCAGGTATGTAGG - Intronic
923944342 1:238865535-238865557 CTGAGATGAGGAAGATTTGTTGG - Intergenic
924332529 1:242954395-242954417 CTGAGAAGAATCAGGTTTCTTGG + Intergenic
924402191 1:243696638-243696660 ACAAGAAGAAGCTGATTTGTAGG - Intronic
1063282330 10:4644081-4644103 CTGAAAAGAAGCAGGTTTGATGG - Intergenic
1063355297 10:5393579-5393601 CATGGAAGAAGCAGAGTTCTTGG - Exonic
1064676826 10:17768678-17768700 CAAAGAATCAGCAGATTTCTAGG + Intronic
1065003719 10:21360960-21360982 CAGGAAAGAAGCAGATTTCTTGG - Intergenic
1065980507 10:30890489-30890511 TAGAGAAGGAGCACATTTGGAGG - Intronic
1066450995 10:35530161-35530183 CAGAGCAGAAGCAGATTTACCGG + Exonic
1066952644 10:42136407-42136429 CAGAGAAGAAGGAAATTTCAAGG - Intergenic
1067985222 10:51136262-51136284 TGGAGGAGAAGCAGATTTGCTGG + Intronic
1068084111 10:52353150-52353172 CAGTGAATGATCAGATTTGTTGG - Intergenic
1068230419 10:54164146-54164168 CAGACCAGATGCAGAATTGTCGG + Intronic
1068322689 10:55440528-55440550 CAAAGAAGCAGCATATTTATTGG - Intronic
1071148388 10:82602212-82602234 CAGAGAAGAAACATATTAATGGG - Intronic
1071958290 10:90782798-90782820 CAAAAATGAAGCGGATTTGTGGG - Intronic
1072122181 10:92414292-92414314 CAGAGTAGAAGCAGATGTGATGG - Intergenic
1072549971 10:96469861-96469883 CAGAGAGGCAGCAGAGCTGTGGG + Intronic
1073633484 10:105173348-105173370 AACAGAAGAAGCAGTTTTTTTGG - Intronic
1073816234 10:107210553-107210575 CAGAGAAGATGGAGTTTTCTAGG + Intergenic
1073822522 10:107281223-107281245 CAGGGATGAAGCAGACTTGATGG + Intergenic
1074283897 10:112079895-112079917 CAGAGAAGAAGGAGATTAACAGG - Intergenic
1075612636 10:123865831-123865853 GAGAGAAGAAGCAGAGATGGAGG - Intronic
1076038335 10:127220591-127220613 AAGGGAAGAAGGAGCTTTGTGGG + Intronic
1076696806 10:132251094-132251116 CAGATAGGAGGCAGATGTGTGGG - Intronic
1078525135 11:12094936-12094958 CAGAGAATTAGCAGTTTTGCAGG - Intronic
1078619546 11:12894314-12894336 CTGAGGACTAGCAGATTTGTAGG + Intronic
1080119083 11:28655535-28655557 CAGAGAGGAAAGAGATTTGGAGG + Intergenic
1080307655 11:30854089-30854111 TAGTCAAGAAGCAGAGTTGTGGG + Intronic
1080515775 11:33018322-33018344 CAAAGAAAAAGGACATTTGTTGG - Intronic
1081728828 11:45354252-45354274 AGGAGAAGAAGCTGATGTGTGGG - Intergenic
1082669245 11:56014110-56014132 CAAAGAACCAGCAGATTTGGTGG + Intergenic
1082839173 11:57674843-57674865 CAGAGAAGTTGTAGATTTTTTGG + Intronic
1083138130 11:60699353-60699375 CAGAGGAGAAAATGATTTGTTGG - Intergenic
1084982615 11:72839070-72839092 TAGGCAAGAAGCTGATTTGTGGG - Intronic
1085019201 11:73194647-73194669 CAGAGAAGCAACAGCTTTGATGG - Intergenic
1085898928 11:80673840-80673862 CAGAGAAAAAGGAGAGTTGAAGG - Intergenic
1085962710 11:81481813-81481835 CAGAGAAGCCGCAGATGTCTAGG + Intergenic
1087222857 11:95565112-95565134 AAGAGAAGTAGCAGATTTAGAGG - Intergenic
1087856659 11:103100045-103100067 CAGCAAAGAAACAGATTAGTAGG + Intergenic
1087990816 11:104744026-104744048 CAGAGAAGAGGCAGATTGCAGGG + Intergenic
1088570356 11:111217898-111217920 CAGAGAAGAGGCAAATCTCTAGG + Intergenic
1089067951 11:115676310-115676332 CAGGGAAGAGGAAGGTTTGTGGG - Intergenic
1089773790 11:120821862-120821884 CAAAGATGAAGCAGACTTGATGG + Intronic
1092436656 12:8452724-8452746 CAGAGCAAAAGCAGAATTGTGGG - Intergenic
1092919029 12:13214508-13214530 CAGGGGAAAAGGAGATTTGTCGG - Intronic
1093800462 12:23366166-23366188 CAGAGAAGAAACAGGTTTAGAGG - Intergenic
1095324491 12:40871835-40871857 CAGAAAAAATGCAGATTTTTTGG + Intronic
1095683358 12:45004271-45004293 CAGTGAAAATGCAGGTTTGTTGG - Intergenic
1096396276 12:51269301-51269323 TGGAGAAGAGGCAGATCTGTAGG + Exonic
1097018773 12:56005627-56005649 CAGAGAGGAAGTAGGCTTGTAGG + Intronic
1097408370 12:59220293-59220315 GATAGAAGAAACAAATTTGTAGG - Intergenic
1097634862 12:62110316-62110338 CAGAGATGAAGCCGACTTGATGG + Intronic
1098500143 12:71182830-71182852 GTAAGAAGAAACAGATTTGTTGG + Intronic
1098807878 12:75043141-75043163 CAGAGGACAAGGAGAGTTGTAGG + Exonic
1098876684 12:75872939-75872961 CAAAGAAGGAGCAGATCTGGTGG - Intergenic
1099415316 12:82377988-82378010 TAGAGAAGAAGCACAAGTGTCGG - Intronic
1099819296 12:87689608-87689630 CAGAGAAGAAACAGATATATGGG + Intergenic
1100368933 12:93947343-93947365 CTGATAAGAAGGAGATTAGTAGG - Intergenic
1100370303 12:93963241-93963263 CTGACAAGAGGCAGATTTATAGG - Intergenic
1100387536 12:94117892-94117914 CAGGCAACAAGCAGTTTTGTAGG - Intergenic
1100477480 12:94947997-94948019 AAGAAAAGAAGCTGATATGTTGG + Intronic
1101779515 12:107823108-107823130 CTGAGAAAAATCAGATTTATTGG - Intergenic
1104407800 12:128532979-128533001 TTTAGAAGAAGCAGCTTTGTAGG + Intronic
1105455466 13:20536774-20536796 AAATGAAGAAGCAGATATGTAGG - Intergenic
1105577199 13:21664925-21664947 CAGAGCAGAAGCAGAAGAGTAGG - Intergenic
1106086231 13:26544396-26544418 CTGAAAAGAAGCACATTTGCTGG - Intergenic
1106088464 13:26563750-26563772 CAGAGAAGAGGCACATGTGCAGG - Intronic
1106344823 13:28865742-28865764 CAGAGAAGGAGCAGTATTATTGG + Intronic
1106785092 13:33099519-33099541 AAGAGGAGAAGCAGATTCGTGGG - Intergenic
1107031954 13:35862309-35862331 GAGATAGGAAGCAGGTTTGTTGG - Intronic
1107677013 13:42807969-42807991 CAGAGAAGAGGTAGATTTACAGG - Intergenic
1107808939 13:44180831-44180853 CCAGGAATAAGCAGATTTGTTGG - Intergenic
1108345511 13:49542657-49542679 CAGAAAAGAAGAAAAATTGTCGG - Intronic
1109903886 13:68812240-68812262 CAGAGACGTAACAAATTTGTGGG - Intergenic
1110117264 13:71834817-71834839 CAGAGAAGATGCATAATTTTTGG + Intronic
1110235253 13:73211222-73211244 CAGAGAAAAAGCATATTTCGGGG + Intergenic
1110911431 13:80970449-80970471 CAGAGAAAAGGCAAATATGTTGG + Intergenic
1112342013 13:98560453-98560475 CAGATGAGAAGGAGATTTGCAGG - Intronic
1113672245 13:112183127-112183149 CAGGGAAGAAGAGGATGTGTGGG + Intergenic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114544249 14:23486905-23486927 CAGACAAGAAGGAGATTTAAAGG - Intronic
1115285609 14:31710550-31710572 CAGAGAAAAATCAGATTTAGTGG + Intronic
1115471855 14:33776172-33776194 TAGAGAAGAAATAGCTTTGTGGG - Intronic
1115881655 14:37926082-37926104 AAGATCAGAAGCAGATGTGTTGG - Intronic
1116653340 14:47622221-47622243 GAGAGAAGAAGAAGATTTGGAGG + Intronic
1116744730 14:48803206-48803228 CAGAAAAGAACCAAATGTGTGGG + Intergenic
1116966924 14:51024722-51024744 CAGAGGAGAAGCATTATTGTGGG + Intronic
1117070000 14:52047743-52047765 CTGAGGAGGAGCAGGTTTGTGGG + Intronic
1118033411 14:61840183-61840205 AAGAGAAGAAGCAGATTTGGAGG + Intergenic
1119892366 14:78192448-78192470 CAGAGAAAAAGAAGACTTCTTGG + Intergenic
1120508642 14:85384860-85384882 AAGAGTAGAAGAAGATTGGTTGG - Intergenic
1121167839 14:91824440-91824462 CAGAGGAAAAGCAGGTTTGCAGG - Intronic
1122635107 14:103126134-103126156 CAGGGAGGAAGCACAGTTGTTGG + Intronic
1124704422 15:31951148-31951170 CAGAGAAAAATTAGAATTGTTGG - Intergenic
1125869867 15:43089951-43089973 AACAGAAAAAGCACATTTGTGGG + Intronic
1126255808 15:46624335-46624357 CAGGGAAGAAAAAGATTTCTAGG + Intergenic
1126720425 15:51572588-51572610 CAGGGATGAAGCCGATTTGATGG - Intronic
1128672420 15:69584219-69584241 CAGAGAAGAGGCAGATTCAGGGG - Intergenic
1129224813 15:74162951-74162973 CAGAGAAGAAGCAGTGGTGAGGG - Intergenic
1129296331 15:74602267-74602289 CAGAGAAGAGGAAGAGCTGTGGG + Intronic
1130380164 15:83365145-83365167 CGGAGAAGATGCAGATGAGTAGG - Intergenic
1131411037 15:92208603-92208625 CTGAGAAAAATCAGATTTATTGG - Intergenic
1131787710 15:95931058-95931080 CAGAGAATAAGCAGGGGTGTGGG + Intergenic
1132235847 15:100220700-100220722 CAGAGACAAAGTAGATTAGTGGG - Intronic
1134875104 16:17691172-17691194 AAGGGAAGAAGCAGAGATGTGGG + Intergenic
1135274134 16:21096683-21096705 AAGAGAAGTGACAGATTTGTTGG - Intronic
1136005235 16:27324818-27324840 GAGAAGAGAAGCAGATTTGCTGG - Intronic
1137087916 16:36151644-36151666 CAGAGAAGAAGGAAATTTCAAGG + Intergenic
1139108887 16:63864349-63864371 CAGAAAAGAAGCAAATATTTTGG + Intergenic
1139672720 16:68502647-68502669 AATAGTAGAAGCAGATTTGGGGG - Intergenic
1139846978 16:69928275-69928297 CAGGAGAGAAGCAGATTTGAAGG + Intronic
1140097438 16:71886847-71886869 CAGACAGAAAGTAGATTTGTGGG - Intronic
1140457136 16:75112095-75112117 CAGAGAGGAAGCAGCTTTGCTGG + Exonic
1140658288 16:77162918-77162940 CAGGGAAGAATCAGGTGTGTTGG + Intergenic
1141366985 16:83452615-83452637 TATAGAATAACCAGATTTGTTGG + Intronic
1142615548 17:1132293-1132315 CACAGATGAGGCAGATTTGAGGG - Intronic
1143309240 17:5974928-5974950 CAGAGAAGAAGGAGTTGAGTTGG + Intronic
1144948632 17:18982414-18982436 CAGAGACAATGCAGCTTTGTGGG - Intronic
1145902198 17:28496365-28496387 CAGAGAAGCAGGAGAATTGGGGG + Intronic
1146614186 17:34339192-34339214 CAGAGAATATGCAGTTTTCTAGG + Intergenic
1146933511 17:36794888-36794910 CAGAGAAGAGGGAGATGTGTGGG + Intergenic
1147856671 17:43485848-43485870 AACAGAAAAAGCATATTTGTGGG - Intronic
1148050516 17:44767859-44767881 CAGAGAGGAAGCAGGCTTGATGG + Intronic
1148546463 17:48522848-48522870 CAGAGAAGAAATAATTTTGTAGG - Intergenic
1148556999 17:48584795-48584817 CAGCGAAGAGGCAGATATCTGGG - Intronic
1149892258 17:60400542-60400564 AACAGGAGAAGGAGATTTGTGGG + Intronic
1150141839 17:62736906-62736928 CACAAAAGAAGTAGATTTGGGGG - Exonic
1151205482 17:72503315-72503337 CTGAGACTAAGCAGATCTGTGGG + Intergenic
1151512132 17:74567291-74567313 CAGAGAAGGAGCAGAGCTGAAGG + Intergenic
1153358012 18:4159491-4159513 CAGAGAAGAAGCTTAATTTTTGG - Intronic
1153450293 18:5219575-5219597 CAGAGCAGAAGCTGATGTGGAGG + Intergenic
1153676494 18:7460264-7460286 AACAGAACAAGCAGATTTCTAGG - Intergenic
1156857506 18:41799368-41799390 TCAAGATGAAGCAGATTTGTAGG + Intergenic
1156915446 18:42461044-42461066 AACAGAGGAAGCAGCTTTGTAGG + Intergenic
1157087833 18:44599945-44599967 CAGCTAAGAAGCAGGTTTTTCGG + Intergenic
1157382770 18:47234939-47234961 CATGGAAGAAGCATATTTCTTGG + Intronic
1157894991 18:51457335-51457357 CAGAGGAGCAGCAGATGTGGTGG + Intergenic
1158207388 18:55008442-55008464 CAGAGAAGAATCTGATGAGTGGG - Intergenic
1158436776 18:57439799-57439821 AAGAGAAGAGGCAGGTTTGGCGG - Intronic
1159349032 18:67247455-67247477 AAGAGTAGAAGCAGATTAGGAGG + Intergenic
1159459669 18:68708479-68708501 CACAGAAGTAACAGATTGGTTGG - Intronic
1159859877 18:73635023-73635045 CAGAAAAGCAGCAGCTTTGCAGG - Intergenic
1160923555 19:1532056-1532078 CAGTGAAGAGGCAGATTAGGAGG + Intronic
1166398720 19:42462037-42462059 GGCAGAAGAAGCAGAATTGTGGG + Intergenic
1166432969 19:42741985-42742007 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166436075 19:42767211-42767233 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166445957 19:42857239-42857261 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166448937 19:42881199-42881221 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166453336 19:42919390-42919412 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166465614 19:43027974-43027996 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166471756 19:43084178-43084200 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166482892 19:43187994-43188016 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166485375 19:43207127-43207149 CAGGGAAGGAGCAGGTGTGTGGG + Intronic
1166492521 19:43271046-43271068 CAGGGAAGGAGCAGGTGTGTGGG + Intergenic
925882283 2:8362901-8362923 CCTAAAGGAAGCAGATTTGTAGG + Intergenic
926665873 2:15522402-15522424 ATGAGAAGAAGCAGGTTTGAAGG + Intronic
926814988 2:16791384-16791406 CAGCCAAGAAGCAGATTGGAGGG - Intergenic
927096383 2:19750506-19750528 CAGAGGAGAAGGAGGTCTGTGGG + Intergenic
927297386 2:21470185-21470207 CAGAGCAGATGCTGATTTGCTGG - Intergenic
927604671 2:24476100-24476122 CAGAGAATAAAAAGATTTGTTGG - Intergenic
928122493 2:28593073-28593095 CAAAGAAGAAACAGATGTGAGGG - Intronic
928310845 2:30208482-30208504 CAAAGAAGAAACAGATTTGGTGG + Intergenic
928541577 2:32289590-32289612 AAAAGAAAAAGCACATTTGTAGG - Intronic
929375666 2:41283765-41283787 CTGAGAAGAAGCATATTAATAGG - Intergenic
929596924 2:43181789-43181811 CAGAGGAGGGGCAGATTTGTTGG + Intergenic
930341059 2:50115325-50115347 CACAGAAGAAACAAATTTCTGGG + Intronic
930625565 2:53693560-53693582 TACAGAATAAGCAGATTTTTAGG + Intronic
931150168 2:59564539-59564561 CAGAGAAGAAAAGAATTTGTAGG - Intergenic
931980263 2:67686777-67686799 AAGAGAAGAACCAGGTTAGTTGG - Intergenic
932895746 2:75637859-75637881 GGGAGAAGGAGCAGATTTGTGGG - Intergenic
933056892 2:77681637-77681659 CAGTCAAGTAGAAGATTTGTGGG - Intergenic
933562923 2:83911877-83911899 AATACAAGAAGCATATTTGTGGG + Intergenic
933749031 2:85591392-85591414 GAGAAAAGAATCAGCTTTGTGGG + Intronic
933927024 2:87102781-87102803 CAGTCAAGTAGAAGATTTGTGGG - Intergenic
934232251 2:90194614-90194636 AAGGAAAGAAGCAGATTTATAGG - Intergenic
937026790 2:118705542-118705564 CAGTGGAGAAACAGATTTGAAGG + Intergenic
937084327 2:119160493-119160515 GAGAGAAGGAGCACATTTATTGG + Intergenic
938837471 2:135121346-135121368 CAGAGAAGAAAAATATATGTAGG + Intronic
939728076 2:145748187-145748209 TGGGGAAGAAGCAGATTTGGGGG + Intergenic
940030160 2:149253624-149253646 CAGAGATGAAGCCGACTTGATGG + Intergenic
942395737 2:175547486-175547508 GAGAGAAAAACCTGATTTGTAGG - Intergenic
944059965 2:195562212-195562234 AAAAGCAGAAGCAGATGTGTGGG + Intergenic
947186010 2:227456349-227456371 GAGAGAAGAAAGAGCTTTGTGGG + Intergenic
947230501 2:227880793-227880815 CAGAGGAGAAGCAGTGTTGAAGG + Intronic
948045055 2:234937140-234937162 CAGAGAGGAAGCAGTTCTGAGGG - Intergenic
1169010587 20:2246917-2246939 CAGAGAGGAAGCAGATGGGGTGG - Intergenic
1169223251 20:3839531-3839553 CAGAAAGGAAGCAGCTGTGTAGG + Intergenic
1169813602 20:9633646-9633668 CAGAGCAGAAGCTGATGTGAAGG - Intronic
1169879544 20:10331546-10331568 CAAAGAAGAAGGAGATTAGGAGG + Intergenic
1169983288 20:11411728-11411750 TAGAAAAGAAGAAGATTTGGGGG - Intergenic
1170052341 20:12159594-12159616 CAAAGAAGAAACAGATTGCTGGG - Intergenic
1170323002 20:15121927-15121949 CAAAGAAGAAATAAATTTGTGGG + Intronic
1170730338 20:18969253-18969275 CAGGGATGAAGCAGACTTGATGG - Intergenic
1171212009 20:23324446-23324468 TGGAGAAGAAGAAGGTTTGTGGG + Intergenic
1172439345 20:34954785-34954807 CAGAGAAGAAGCAGATTTGTGGG - Intronic
1172586814 20:36091493-36091515 CAGTGAAGAACCAGAATTGTTGG + Intronic
1173103329 20:40107841-40107863 CAGCCAAGAAGCAGCATTGTAGG - Intergenic
1173381604 20:42549457-42549479 CAGAGAAGAAGGAGATAAGAGGG + Intronic
1174613833 20:51820664-51820686 CAGATAAGAAACAGGTTTATGGG + Intergenic
1175485908 20:59346072-59346094 CAGAGAAGGAGCAGGTTTGGGGG + Intergenic
1175717800 20:61266967-61266989 CAGAGAAGACACAGACTTGGAGG + Intronic
1177375148 21:20260388-20260410 CAGAGAAGTAGCAGAATCATTGG + Intergenic
1178997434 21:37416415-37416437 CAGAGAAAAAGCAGTTATATAGG - Intronic
1179840728 21:44071516-44071538 TAGAGAAGAAGCAGAGTGCTCGG + Intronic
1179877456 21:44277326-44277348 CACAGAATAGGCAGATCTGTAGG - Intergenic
1180669468 22:17542203-17542225 CAGAGGAGAAGCAAATGTGCGGG + Exonic
1180728579 22:17964199-17964221 CTGAGGAGAGGCAGATTTTTTGG - Intronic
1182125888 22:27815657-27815679 CAGAGAAGAGGCAGGTGTGGGGG + Intergenic
1184091764 22:42296585-42296607 CAGAGAGGAAGCAGCTTGGCTGG + Intronic
1184694115 22:46130380-46130402 CAGAGATGAAGCAGGGCTGTGGG + Intergenic
1203323876 22_KI270737v1_random:97924-97946 CAGAGAAGAAGGAAATTTCAAGG - Intergenic
950159898 3:10752500-10752522 AAGAGAAGCAGCTGATTTCTGGG + Intergenic
952055903 3:29445480-29445502 CATAGAATTAGCAGATTTGGTGG - Intronic
952139490 3:30462348-30462370 CAGAGAAGAAGGAGAAATGTGGG + Intergenic
952551616 3:34485086-34485108 CAAGGAAGAAGCAGAGATGTGGG + Intergenic
952763286 3:36934265-36934287 CTGAGAAGAAGCCAATTTCTGGG + Intronic
953254847 3:41279592-41279614 CAGACTAGTAGCAGATTTCTTGG + Intronic
955544678 3:60015556-60015578 CACAGAAAAAGCAGCTTCGTGGG - Intronic
956480247 3:69665990-69666012 AAGAGAAGAAGCAGAACTGAAGG + Intergenic
957849179 3:85783369-85783391 CAAATAAGAAGCAGAAGTGTTGG - Intronic
957907031 3:86570223-86570245 CAGAGCAGAAGGAGATTGGCTGG + Intergenic
958501102 3:94910142-94910164 CTGAGAAGAAGCAGATTAATAGG - Intergenic
959830653 3:110857818-110857840 CAAAGTAGAAGCAGAGTTTTAGG + Intergenic
961349924 3:126293371-126293393 CAGAGGAGAAGCTGGCTTGTGGG + Intergenic
962133708 3:132710210-132710232 AAGAGAAGATGTAGCTTTGTGGG + Intronic
962846166 3:139275603-139275625 CAGAGAAGAATAAGCTGTGTAGG + Intronic
963255895 3:143144719-143144741 CAAAGTAGAAGCATATGTGTGGG - Intergenic
964312695 3:155411504-155411526 CAGACAAGATGCAGATTAATAGG - Intronic
964450100 3:156804024-156804046 CACAGAAGAAACAGTTTTGAAGG + Intergenic
965303321 3:167031596-167031618 GAGAGGAGAACCAGATTTGTGGG - Intergenic
965346337 3:167555552-167555574 AAAGGAAGAAGCAGACTTGTGGG + Intronic
965562585 3:170075740-170075762 CAGAGATGAAGCAGGCATGTGGG + Intronic
966649138 3:182279854-182279876 AAGATAATAAGCAGATCTGTTGG + Intergenic
967120010 3:186374386-186374408 CAGGGAAGATGCAAATGTGTGGG - Intergenic
968816067 4:2822664-2822686 CAAAGAAGAGGTAGATTTGGGGG - Intronic
970156663 4:13149138-13149160 CAGAGAAGAAGCACAGTTATAGG - Intergenic
970423946 4:15929535-15929557 CAGAGCAGAAGCAGGTGTGGGGG - Intergenic
971037270 4:22707360-22707382 TAGAGAAGGAGCAGACTTGGAGG + Intergenic
971476858 4:27080653-27080675 CAGAGAAAAAGCAGATGCATTGG - Intergenic
972105081 4:35474647-35474669 CAGAGAAGAAATAGGTTTGCAGG + Intergenic
972168631 4:36318190-36318212 CACACAGGAAGCAGATTTCTTGG - Intronic
972808344 4:42554583-42554605 TAGAGAAGATGCATATTTGAGGG + Intronic
973220450 4:47720617-47720639 CATACAAGAAGTAGATGTGTAGG - Intronic
973778498 4:54266064-54266086 CAGGGAAGATGTACATTTGTTGG - Intronic
974014931 4:56640337-56640359 CAGAGCTGCAGCAGATTTGAGGG + Intergenic
974135281 4:57808852-57808874 CAGAAAAGAAGCCACTTTGTGGG - Intergenic
974156261 4:58077262-58077284 CAGAGATGAAGTGGCTTTGTGGG + Intergenic
974847225 4:67365527-67365549 CAGAGAAAAGGCAGATGGGTGGG + Intergenic
975465558 4:74705253-74705275 CAGTGAACAAGCAGAGTTGTGGG + Intergenic
977221622 4:94344528-94344550 CAGAGAAGAAGTGGCTCTGTTGG - Intergenic
977765855 4:100796728-100796750 CAGAAAAGGAGCAGATGAGTGGG + Intronic
977980947 4:103320983-103321005 TAGAGAAGCAGCAGAATGGTAGG + Intergenic
979208133 4:118065929-118065951 CTGAGTAGAATCAGATTTCTGGG + Intronic
980085514 4:128386493-128386515 CAGAAAACAAGCAGATTCCTGGG - Intergenic
980277196 4:130668554-130668576 CTTAGAAGAAGCATATTTGTAGG + Intergenic
980713666 4:136603708-136603730 AAAAGGAGAAGCAGATTCGTAGG + Intergenic
980849866 4:138367886-138367908 CAGAGAAAAAGCATTTTTATTGG - Intergenic
981636002 4:146879935-146879957 CAGTGATGATGAAGATTTGTGGG - Intronic
982374712 4:154677190-154677212 AGGAGAAGAAGCAGATTTAGGGG + Intronic
983983688 4:174031391-174031413 CAGAGAAGCAGCAGGTTTTCTGG - Intergenic
985384071 4:189426512-189426534 CAGAGAAGCAGCAGATTAAAAGG + Intergenic
986884202 5:12214013-12214035 CAGAGAAAAAGGATATTAGTGGG + Intergenic
988493115 5:31721880-31721902 CAGAGGAGAAACAGATTTAGGGG - Intronic
988796765 5:34658368-34658390 AAGTGAAGAAGCAGATTTGGAGG + Intronic
991661863 5:68958719-68958741 CACAGAAGAAGCTGACTTGGAGG - Intergenic
993356042 5:86908847-86908869 CAAAGAAAAAGCAGATTGGGAGG + Intergenic
993839057 5:92853510-92853532 CATTGAAGAAGCAAAATTGTAGG + Intergenic
994438942 5:99776962-99776984 CAGTAAAGTAGCAGATTTGGAGG - Intergenic
994621902 5:102173422-102173444 CAGTGAAGAAGCAGAAATGTAGG + Intergenic
994846459 5:104994576-104994598 AAGAAAAGAAGTAGATTCGTAGG + Intergenic
995089295 5:108154009-108154031 CAGATTTGAGGCAGATTTGTTGG - Intronic
995529334 5:113076443-113076465 CAGAGTAGTAGCTGATTTCTTGG + Intronic
995901550 5:117073646-117073668 CAAAGAATAATCAGAATTGTTGG - Intergenic
996247050 5:121277370-121277392 CAGAGTAGATGCTCATTTGTGGG + Intergenic
996317186 5:122173382-122173404 AAGAAAAGAGGCTGATTTGTTGG - Intronic
996705886 5:126497990-126498012 CAGGAGAGAAGTAGATTTGTTGG + Intergenic
998415691 5:141944756-141944778 CAGCTGAGAAGCAGATTAGTTGG + Exonic
999747874 5:154606031-154606053 CAGAGGAGAAGCAACTTTATTGG + Intergenic
999780934 5:154849748-154849770 AAGACAAGATGCTGATTTGTGGG - Intronic
1000276166 5:159736942-159736964 CAGAGGAAAAGCAGAGTTGAGGG - Intergenic
1001117958 5:168955418-168955440 AAGAGGAGAAGCAGAGCTGTGGG - Intronic
1001132227 5:169073717-169073739 AAGAGAAGAAGCAAGGTTGTGGG - Intronic
1001934859 5:175696689-175696711 CACGGAAGAAGCAAAGTTGTGGG - Intergenic
1006185668 6:32180356-32180378 CAGAGAAGAATCAGTATTGAGGG + Exonic
1008435510 6:51471323-51471345 CAAAGAAGAATCAGGTTTGAGGG + Intergenic
1010639316 6:78303854-78303876 CAGTGAGGATGCAGATTTGGAGG - Intergenic
1011239959 6:85260891-85260913 GAGAGCAGAAGCAAAGTTGTTGG + Intergenic
1011273906 6:85609035-85609057 CATAAAAGAAACAGACTTGTGGG - Intronic
1011477531 6:87762691-87762713 CAGAGCAGAAGCAGAGCTGAAGG - Intergenic
1013646600 6:112148368-112148390 CAGAGAAGCCGGATATTTGTTGG + Intronic
1013771782 6:113635617-113635639 CCGAGAAGAAGTACATTTATGGG + Intergenic
1014441719 6:121480941-121480963 CTGCTAAGAAGCAGATTTGGGGG - Intergenic
1014917746 6:127173155-127173177 GAAAGATGAAGCAGATTTGGTGG - Intronic
1016427581 6:143950656-143950678 CAGAGAAGGAGCTGCTTTGTTGG + Intronic
1018395761 6:163377070-163377092 CAGAGAAGGAGCAGGTCTGGAGG - Intergenic
1021020268 7:15589054-15589076 GAGGGATGAAGCAGATTTGATGG + Intergenic
1021285896 7:18780512-18780534 CAGTGAAGAAGCATCATTGTAGG + Intronic
1021292179 7:18859756-18859778 GAGAGAAAAAGAAGCTTTGTAGG - Intronic
1021436391 7:20621724-20621746 CAGAGAAGGAGGTGATTTTTAGG + Intronic
1023180978 7:37483325-37483347 AAGATAAGAAGTAGTTTTGTAGG + Intergenic
1024434489 7:49334239-49334261 CAGTGATCAATCAGATTTGTGGG + Intergenic
1025479836 7:60968548-60968570 CAGAGAAGAAGGAAATTTCAAGG + Intergenic
1025483417 7:61015499-61015521 CAGAAAAGAAGGAAATTTCTAGG + Intergenic
1025552125 7:62263787-62263809 CAGAGAAGAAGGAAATTTCAAGG - Intergenic
1025557933 7:62332915-62332937 CAGAGAAGAAGGAAATTTCAAGG - Intergenic
1026886603 7:73952746-73952768 CAGAGAGGAAACAGATTGGGGGG - Intergenic
1028636043 7:92990172-92990194 CAAAGTAGAAGCAGATTTCCTGG - Intergenic
1029548558 7:101224079-101224101 CAGATAAGACACAGTTTTGTTGG - Exonic
1030059377 7:105610807-105610829 CAGAGGAAAAGTAGAATTGTGGG + Intronic
1030448149 7:109673382-109673404 CAGGGATGAAGCAGACTTGGTGG - Intergenic
1031247453 7:119333636-119333658 TAGAGAAGAAGAACATTTCTAGG + Intergenic
1033109661 7:138563001-138563023 CAGAGAAGAGGCCACTTTGTTGG - Intronic
1033249356 7:139745614-139745636 AAGAGGAGGAACAGATTTGTGGG - Intronic
1033564514 7:142565680-142565702 CAGAGAAATAGAAGAATTGTAGG - Intergenic
1033775594 7:144606676-144606698 AAGAGAAGGAACAGATTTCTGGG - Intronic
1033825408 7:145183904-145183926 TAGAGAAGAAGCAGAAATTTGGG + Intergenic
1034787992 7:153942795-153942817 CAGGGAAGAGGCAGAATGGTAGG - Intronic
1035556714 8:572652-572674 CACAGCAGAGGCAGAATTGTGGG + Intergenic
1036221656 8:6926057-6926079 GAGAGCAGGAGCAGATGTGTGGG + Exonic
1036227141 8:6969136-6969158 GAGAGCAGGAGCAGATGTGTGGG + Intergenic
1036459651 8:8940553-8940575 CAGAGATGAAGGAGGTTGGTAGG + Intergenic
1036648407 8:10626122-10626144 CAGGGAGGAAACAGTTTTGTTGG + Intronic
1036801876 8:11798621-11798643 CACAGGAGAAGCAGATTTAATGG + Intronic
1038212027 8:25527391-25527413 CAGGGATGAAGCCGATTTGGTGG - Intergenic
1038884381 8:31647445-31647467 CAGTGAAGCAGCAGATGTGGTGG + Intronic
1038899837 8:31830225-31830247 CAGAGAAGAAAAAGATTGCTTGG + Intronic
1038909996 8:31952389-31952411 CAGAGAAGAAGCAAAATTTGTGG + Intronic
1039394492 8:37213162-37213184 AAGAGAAAAAGTAGATATGTTGG + Intergenic
1039423696 8:37467655-37467677 CATAGAAGCAGCAGGTTTGAGGG + Intergenic
1039822745 8:41148035-41148057 CAGAGAAGAGGCTGCCTTGTTGG - Intergenic
1039888616 8:41669785-41669807 CAGAGAAGCAGGAGGTGTGTCGG - Intronic
1040808782 8:51426118-51426140 AACAGAAGAAGCAGTTATGTTGG + Intronic
1041777352 8:61537803-61537825 CAGAGAGAAAGCCAATTTGTAGG + Intronic
1042220628 8:66469929-66469951 TCGAAAAGAAGCAGTTTTGTAGG + Intronic
1042533796 8:69839492-69839514 GAGAGAGGAGGCAGTTTTGTGGG - Intergenic
1043027187 8:75084619-75084641 CACATAATAAGCACATTTGTTGG - Intergenic
1043360008 8:79461163-79461185 GAGAGAAGAAGCACATTGATGGG - Intergenic
1043865646 8:85372206-85372228 CAGAGAAGACCCAGGTTTTTGGG + Intronic
1044605109 8:94041570-94041592 CAGAGAAGCACCATAATTGTGGG + Intergenic
1045683078 8:104683283-104683305 CAGAGAAGAAACAGAGATGAAGG + Intronic
1045899170 8:107255153-107255175 AAGAGAAGAAGAAAATTTGATGG + Intronic
1046564097 8:115876492-115876514 CTTGGAAGAAGCAGAGTTGTTGG - Intergenic
1046604196 8:116352505-116352527 CAAGGAAGAAGTAGTTTTGTTGG + Intergenic
1046740139 8:117819280-117819302 AATAGAAGAAGCAGACTTGTTGG - Intronic
1047348372 8:124050069-124050091 CAGAGAGGAAGCAAACATGTGGG + Intronic
1047353598 8:124099337-124099359 TAGAGAAGAAACAGTGTTGTAGG - Intronic
1047680634 8:127250867-127250889 CAGTGAAGATGCAAATGTGTGGG - Intergenic
1048461254 8:134623491-134623513 CAGAGGAGATGCAGATTTGGAGG - Intronic
1049163133 8:141110432-141110454 CAGAGGAGAAGCAGGAGTGTGGG - Intergenic
1049409812 8:142467526-142467548 CAGAGGAGAAGAAGATCTGGAGG + Intronic
1052402846 9:28022839-28022861 CAGAGAACATCCAGAGTTGTAGG - Intronic
1053048570 9:34939734-34939756 CTGAGTAGAAGTAGATGTGTGGG - Intergenic
1053052581 9:34973990-34974012 AAAAGAAGAAGAAGATTTGTTGG - Intronic
1053512363 9:38699361-38699383 CCTCCAAGAAGCAGATTTGTGGG + Intergenic
1053534919 9:38915834-38915856 CAGATAAGAAGCATATGTGAAGG + Intergenic
1054207137 9:62140256-62140278 CAGATAAGAAGCATATGTGAAGG + Intergenic
1054631213 9:67448098-67448120 CAGATAAGAAGCATATGTGAAGG - Intergenic
1055649353 9:78392222-78392244 TAGAGGAGAAGCACATTTTTAGG - Intergenic
1055857332 9:80705847-80705869 CAGGGAAGAAGTGCATTTGTGGG - Intergenic
1055865557 9:80809079-80809101 TAGAGGAGAAGCAGGTTTGAGGG + Intergenic
1058326162 9:103700632-103700654 CAGAGATGAATCAGAGTTGATGG + Intergenic
1060954615 9:127629647-127629669 CGGAGAAGAGACAGGTTTGTGGG + Intronic
1185510564 X:661080-661102 CAGAAAAGAAGAAGAAATGTGGG - Intergenic
1186100156 X:6147220-6147242 CAGAGAAAAAGCACAGGTGTAGG + Intronic
1186164721 X:6814256-6814278 GATAGAAGAAAAAGATTTGTAGG - Intergenic
1186568166 X:10686517-10686539 CAGACAAGAGGCAGATTAATAGG - Intronic
1186580809 X:10816062-10816084 TAGGAAAGAAGCAGATTGGTGGG - Intronic
1187780380 X:22815729-22815751 TAGAGAAGAAGCAGATTGATTGG + Intergenic
1188434229 X:30142145-30142167 CAGAGCAGAAGCAGAACTCTGGG - Intergenic
1188709722 X:33380123-33380145 CAAAGAAGAAGCAGGTTTCACGG + Intergenic
1189184115 X:39037162-39037184 AAAAGAAGGAGCATATTTGTGGG + Intergenic
1193818908 X:86138179-86138201 TAGAGGAGAAGCAGAATTTTAGG + Intergenic
1194112876 X:89856709-89856731 TAGAGTATAAGAAGATTTGTAGG - Intergenic
1194909503 X:99623228-99623250 AAGGGAAGCAGCATATTTGTAGG - Intergenic
1195720988 X:107867824-107867846 TAGAGAAGAATCAGATTTAATGG + Intronic
1196675908 X:118419899-118419921 GTGAGGAGAAGCAGGTTTGTGGG - Intronic
1197351515 X:125388597-125388619 CTGACAAGAGGCAGATTAGTAGG + Intergenic
1197873102 X:131078663-131078685 CAGACAAGAAGCAGATGGGTGGG - Intronic
1199202778 X:145112504-145112526 CAGAGTAGAAGCAGATTCACAGG - Intergenic
1200317950 X:155154184-155154206 CAGATCAGCAGCAGATTTCTTGG - Intergenic
1200375287 X:155774014-155774036 CAGAGACCAATCAGACTTGTGGG - Exonic
1200465529 Y:3511522-3511544 TAGAGTATAAGAAGATTTGTAGG - Intergenic
1201229851 Y:11853649-11853671 CTGAGAAGAATCAGGTTTCTTGG + Intergenic
1201335454 Y:12876028-12876050 AAGAGATGAAGCAAAGTTGTTGG + Intergenic