ID: 1172442754

View in Genome Browser
Species Human (GRCh38)
Location 20:34977662-34977684
Sequence CTACCTCGGCACCACGGTGA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 81}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172442754_1172442773 22 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442773 20:34977707-34977729 CCGAAGGGAGGGCAGGAGGGTGG 0: 1
1: 0
2: 10
3: 309
4: 4473
1172442754_1172442764 -3 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442764 20:34977682-34977704 TAGGTGATCAGGGCTGGGGTTGG 0: 1
1: 0
2: 2
3: 36
4: 427
1172442754_1172442761 -9 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442761 20:34977676-34977698 CCGAGGTAGGTGATCAGGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 143
1172442754_1172442769 15 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442769 20:34977700-34977722 GTTGGAGCCGAAGGGAGGGCAGG 0: 1
1: 0
2: 1
3: 29
4: 276
1172442754_1172442774 23 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442774 20:34977708-34977730 CGAAGGGAGGGCAGGAGGGTGGG 0: 1
1: 0
2: 9
3: 311
4: 4528
1172442754_1172442771 19 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442771 20:34977704-34977726 GAGCCGAAGGGAGGGCAGGAGGG 0: 1
1: 0
2: 2
3: 112
4: 1403
1172442754_1172442765 6 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442765 20:34977691-34977713 AGGGCTGGGGTTGGAGCCGAAGG 0: 1
1: 0
2: 5
3: 66
4: 521
1172442754_1172442762 -8 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442762 20:34977677-34977699 CGAGGTAGGTGATCAGGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 118
1172442754_1172442763 -7 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442763 20:34977678-34977700 GAGGTAGGTGATCAGGGCTGGGG 0: 1
1: 0
2: 2
3: 38
4: 379
1172442754_1172442767 10 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442767 20:34977695-34977717 CTGGGGTTGGAGCCGAAGGGAGG 0: 1
1: 0
2: 1
3: 29
4: 374
1172442754_1172442775 26 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442775 20:34977711-34977733 AGGGAGGGCAGGAGGGTGGGCGG 0: 1
1: 4
2: 495
3: 6528
4: 15891
1172442754_1172442777 30 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442777 20:34977715-34977737 AGGGCAGGAGGGTGGGCGGGTGG 0: 1
1: 2
2: 23
3: 686
4: 8685
1172442754_1172442768 11 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442768 20:34977696-34977718 TGGGGTTGGAGCCGAAGGGAGGG 0: 1
1: 0
2: 1
3: 46
4: 727
1172442754_1172442770 18 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442770 20:34977703-34977725 GGAGCCGAAGGGAGGGCAGGAGG 0: 1
1: 0
2: 11
3: 106
4: 1147
1172442754_1172442776 27 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442776 20:34977712-34977734 GGGAGGGCAGGAGGGTGGGCGGG 0: 2
1: 4
2: 34
3: 928
4: 9149
1172442754_1172442766 7 Left 1172442754 20:34977662-34977684 CCCTCACCGTGGTGCCGAGGTAG 0: 1
1: 0
2: 0
3: 15
4: 81
Right 1172442766 20:34977692-34977714 GGGCTGGGGTTGGAGCCGAAGGG 0: 1
1: 0
2: 4
3: 50
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172442754 Original CRISPR CTACCTCGGCACCACGGTGA GGG (reversed) Exonic
904259456 1:29280093-29280115 CGGCCTCAGCAGCACGGTGATGG - Exonic
905675324 1:39820637-39820659 CTCCCTCGGCACCACGGGACTGG - Intergenic
908247992 1:62243067-62243089 CTACCTGGGCACCACTGTGCCGG + Intronic
910636103 1:89409790-89409812 CTGCCTGGGCACCATAGTGAAGG + Intergenic
919907557 1:202088337-202088359 CCAGCTCGTCACCATGGTGATGG + Intergenic
1063001433 10:1927487-1927509 CTACCTCAGCAACACAGTGGAGG + Intergenic
1077000819 11:321347-321369 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000828 11:321386-321408 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000836 11:321425-321447 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000844 11:321464-321486 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000852 11:321503-321525 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000860 11:321542-321564 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000868 11:321581-321603 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000876 11:321620-321642 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000886 11:321659-321681 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000894 11:321698-321720 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000904 11:321737-321759 CTGCCTGGGCACCACACTGAAGG - Intronic
1077000913 11:321776-321798 CTGCCTGGGCACCACACTGAAGG - Intronic
1077000921 11:321815-321837 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000930 11:321854-321876 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000938 11:321893-321915 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000948 11:321932-321954 CTGCCTGGGCACCACACTGAAGG - Intronic
1077000957 11:321971-321993 CTGCCTGGGCACCACACTGAAGG - Intronic
1077000965 11:322010-322032 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077000973 11:322049-322071 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077000983 11:322088-322110 CTGCCTGGGCACCACACTGAAGG - Intronic
1077000992 11:322127-322149 CTGCCTGGGCACCACACTGAAGG - Intronic
1077001000 11:322166-322188 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001009 11:322205-322227 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077001017 11:322244-322266 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001027 11:322283-322305 CTGCCTGGGCACCACACTGAAGG - Intronic
1077001036 11:322322-322344 CTGCCTGGGCACCACACTGAAGG - Intronic
1077001044 11:322361-322383 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001053 11:322400-322422 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077001061 11:322439-322461 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001071 11:322478-322500 CTGCCTGGGCACCACACTGAAGG - Intronic
1077001079 11:322517-322539 CTGCCTGGGCACCACAGTGAGGG - Intronic
1077001088 11:322556-322578 CTGCCTGGGCACCATAGTGAAGG - Intronic
1077001096 11:322595-322617 CTGCCTGGGCACCATAGTGAAGG - Intronic
1078052179 11:7975354-7975376 CAACCTGGGCAACATGGTGAAGG + Intronic
1081591324 11:44425336-44425358 CCACCTGGGCACCAAGGTGCTGG + Intergenic
1087032202 11:93716837-93716859 CTGCCTAGGCACCATAGTGAAGG - Intronic
1087871270 11:103295620-103295642 CCACCTGGGCACCATAGTGAAGG + Intronic
1090101059 11:123797295-123797317 CCACCTGGGCACCATAGTGAAGG - Intergenic
1108337773 13:49463661-49463683 CCACCTGGGCACCACAGTGAAGG - Intronic
1115506464 14:34098402-34098424 CTGCTTCTGCACCAGGGTGAGGG - Intronic
1120154847 14:81082269-81082291 CTGCCTGGGCACCATAGTGAAGG + Intronic
1121529383 14:94641634-94641656 CTCCTCAGGCACCACGGTGAGGG - Intergenic
1122823569 14:104359089-104359111 CTACCTCGGCCCCAGGAGGAGGG - Intergenic
1125326287 15:38538934-38538956 GTACTTCAGCACCAGGGTGAGGG - Intronic
1125584138 15:40808303-40808325 CTTCCGGGGCACCATGGTGAAGG + Intronic
1128725368 15:69984003-69984025 CCACCTGGGCAGCAGGGTGATGG - Intergenic
1129981753 15:79878547-79878569 CCACCTGGGCACCATAGTGAAGG - Intronic
1133945336 16:10343275-10343297 CCATCTGGGCACCACAGTGAAGG + Intronic
1134220347 16:12348657-12348679 CTAGCTCAGCATCACAGTGATGG + Intronic
1142432383 16:90036798-90036820 CCCCCTCTGCACTACGGTGAGGG - Intronic
1142790223 17:2258359-2258381 CAACCTGGCCAACACGGTGAAGG + Intronic
1147841289 17:43373528-43373550 CTGCCTGGGCACCATAGTGAAGG + Intergenic
1151923502 17:77175540-77175562 CTGCCCGGGCACCACAGTGAAGG - Intronic
1155732688 18:29180556-29180578 CTGCCTGGGCACCATAGTGAAGG - Intergenic
1158635144 18:59149604-59149626 CTACCTCAGCACCACCACGATGG - Exonic
1163413622 19:17172402-17172424 CTTCCTGGGCACCCCGGTCATGG + Exonic
1163587731 19:18173204-18173226 GTCCCACGGGACCACGGTGAGGG + Intronic
1164044072 19:21519398-21519420 CCACCTAGGCACCATAGTGAAGG + Intronic
1165060750 19:33204228-33204250 CCACCTCGGGACCACTGGGATGG - Intronic
1167496271 19:49820450-49820472 CTGCCTGGGCACCACAGTGAAGG - Intronic
925155990 2:1649277-1649299 CGACCTCGACTCCACGGTGGTGG - Exonic
926764409 2:16311675-16311697 ATCCCACTGCACCACGGTGAGGG + Intergenic
927132729 2:20074144-20074166 CTGCCTGGGCACCATAGTGAAGG + Intergenic
928896180 2:36266377-36266399 CTACCTCTGAACCAGGGTAAGGG - Intergenic
932651338 2:73561171-73561193 CTGCCTGGGCACCATAGTGAAGG - Intronic
948723358 2:239917510-239917532 CCACCTGGACACCACAGTGAAGG + Intronic
948980543 2:241492243-241492265 CTACCCCAGCACCCCCGTGAGGG + Intronic
1172442754 20:34977662-34977684 CTACCTCGGCACCACGGTGAGGG - Exonic
1172938654 20:38639369-38639391 CTCACTAGGCACCACGGCGAAGG - Exonic
1177410914 21:20729750-20729772 CTACCTCTGGAGCAAGGTGAAGG - Intergenic
1179916896 21:44483526-44483548 CTCCCTCGGCACCAGTGGGAGGG + Intergenic
959961267 3:112302166-112302188 CTGCCTGGGCCCCACAGTGAAGG + Intergenic
959962013 3:112308220-112308242 GTGCCTGGGCACCACAGTGAAGG + Intergenic
961357467 3:126348102-126348124 CTCCCTCTGCACCCCGGTGTTGG - Intronic
969866078 4:10077881-10077903 CATCCTGGGCACCACGCTGAAGG - Exonic
998343726 5:141441873-141441895 CTACCTGGTCACCAAGGTGGTGG + Intronic
1001275924 5:170351506-170351528 CAACCTAGGCACCATGGAGAAGG - Intergenic
1005423313 6:25675320-25675342 CTGCCTGGGCACCATAGTGAAGG + Intronic
1006450645 6:34103992-34104014 CTACCTCGGGGCCGTGGTGAGGG - Intronic
1006888436 6:37401877-37401899 CTGCCTGGGCACCATAGTGAAGG - Intergenic
1018330688 6:162724879-162724901 CTGCCTGGGCACCACAGAGAAGG + Intronic
1024423627 7:49200141-49200163 CTGCCTGGGCACCATAGTGAAGG + Intergenic
1024579213 7:50788297-50788319 CTACCTGGGCCCCACTGAGATGG - Intronic
1032670484 7:134077788-134077810 CTGCCTGGGCACCATAGTGAAGG - Intergenic
1041724418 8:61004771-61004793 CTGCCTGGGCCCCGCGGTGAGGG + Intergenic
1047398837 8:124528960-124528982 CTGCCTGGGCCCCACAGTGAAGG + Intronic
1052779729 9:32768572-32768594 CTACCTGGGCCCGATGGTGATGG - Intergenic
1061313039 9:129776648-129776670 CTATCTCGGAACCACAGTAAAGG + Intergenic
1186669398 X:11754938-11754960 CCACCTTGGCACCACGGAGCTGG - Intergenic
1195936178 X:110127648-110127670 CTAACTCGGCCCCACAGTGTAGG + Intronic
1200415222 Y:2902980-2903002 CTGCCTGGGCACCACAGTGAAGG + Intronic