ID: 1172443407

View in Genome Browser
Species Human (GRCh38)
Location 20:34980742-34980764
Sequence CGGTTGGGGAGGAGTCCAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 258}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172443407_1172443416 0 Left 1172443407 20:34980742-34980764 CCGCCTGGACTCCTCCCCAACCG 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1172443416 20:34980765-34980787 CAGACCCCGACCTCGGTCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 142
1172443407_1172443417 3 Left 1172443407 20:34980742-34980764 CCGCCTGGACTCCTCCCCAACCG 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1172443417 20:34980768-34980790 ACCCCGACCTCGGTCCCGGGAGG 0: 1
1: 0
2: 1
3: 15
4: 718
1172443407_1172443415 -1 Left 1172443407 20:34980742-34980764 CCGCCTGGACTCCTCCCCAACCG 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1172443415 20:34980764-34980786 GCAGACCCCGACCTCGGTCCCGG 0: 1
1: 0
2: 2
3: 9
4: 448
1172443407_1172443422 14 Left 1172443407 20:34980742-34980764 CCGCCTGGACTCCTCCCCAACCG 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1172443422 20:34980779-34980801 GGTCCCGGGAGGCCTCTGTAAGG 0: 1
1: 0
2: 0
3: 36
4: 173
1172443407_1172443423 15 Left 1172443407 20:34980742-34980764 CCGCCTGGACTCCTCCCCAACCG 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1172443423 20:34980780-34980802 GTCCCGGGAGGCCTCTGTAAGGG 0: 1
1: 0
2: 0
3: 6
4: 96
1172443407_1172443413 -7 Left 1172443407 20:34980742-34980764 CCGCCTGGACTCCTCCCCAACCG 0: 1
1: 0
2: 1
3: 20
4: 258
Right 1172443413 20:34980758-34980780 CCAACCGCAGACCCCGACCTCGG 0: 1
1: 0
2: 0
3: 3
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172443407 Original CRISPR CGGTTGGGGAGGAGTCCAGG CGG (reversed) Intronic
900297664 1:1960117-1960139 GGGATGGGGAGGAGGCCAGGAGG - Intronic
900345985 1:2210470-2210492 GCTTTGGGGAGGAGGCCAGGTGG + Intronic
901626723 1:10629137-10629159 AGGTTGGTGAGGAGTCCAAAAGG - Intronic
901930870 1:12595590-12595612 CGGGTGAGGAGGGGGCCAGGTGG + Intronic
902240901 1:15088711-15088733 GGGCTTGGGAGGAGTCTAGGGGG - Intronic
902375690 1:16029024-16029046 TGGCAGGGGAGGATTCCAGGCGG + Intronic
902936700 1:19769737-19769759 GGGGTGGGGAGGAGCTCAGGAGG + Intronic
903236933 1:21956424-21956446 CGGTTGGGGGTGGGTGCAGGGGG - Intergenic
903271574 1:22191832-22191854 CGGGTGGGAGGGAGTCCAAGTGG + Intergenic
903800546 1:25964011-25964033 CAGCAGGGGAGGAGGCCAGGAGG + Intronic
905280226 1:36844334-36844356 AGGTTGGAGAAGAGTCCACGTGG + Intronic
908703834 1:66930084-66930106 CGGAGGGGGCGGAGTCAAGGTGG - Intronic
915288861 1:154869646-154869668 CGGTGGGAGAGGAGTGCAGCAGG + Exonic
915506054 1:156357149-156357171 CGGAGGGGGAGGAGCCCAGCAGG + Intronic
915622299 1:157093024-157093046 CGGGAGGGGAGGAGTGAAGGAGG + Exonic
921347983 1:214206794-214206816 CAGATGGGGAGGATTCCATGTGG - Intergenic
924366207 1:243296510-243296532 CAGTTGGGGTGGACTACAGGGGG - Intronic
924664620 1:246058325-246058347 AGGTGGGGGAGGAGGGCAGGAGG + Intronic
1063578279 10:7281392-7281414 CCGATGGGGAGAAGTCCAGTGGG - Intronic
1065856971 10:29838886-29838908 GAGATGGGGAGGAGTGCAGGAGG + Intergenic
1067269978 10:44783160-44783182 CAGATCAGGAGGAGTCCAGGTGG - Intergenic
1067508414 10:46875870-46875892 AGGTTGGGGAGGCTTCCTGGAGG + Intergenic
1067653835 10:48175979-48176001 AGGTTGGGGAGGCTTCCTGGAGG - Intronic
1069565845 10:69462889-69462911 GGGTTTGGGAGAAGTGCAGGGGG + Intronic
1069601054 10:69708393-69708415 CGGTTGGAGAGGAGTTCAGCTGG + Intergenic
1071502835 10:86215675-86215697 GGGCTGAGGAGGAGCCCAGGAGG - Intronic
1072301084 10:94063066-94063088 ATGTGGGAGAGGAGTCCAGGTGG - Intronic
1073042537 10:100617418-100617440 CATTTGAAGAGGAGTCCAGGTGG - Intergenic
1073104410 10:101024011-101024033 CGGGTGGAGAAGAGTCCAGCAGG - Exonic
1075609509 10:123841021-123841043 GGGTTGGGGAGGACTGCAGACGG + Intronic
1076829198 10:132985797-132985819 AGGTTGGGGAGGAGACAGGGTGG + Intergenic
1076850226 10:133088856-133088878 CGCTGGAGGAGGCGTCCAGGGGG - Exonic
1076893924 10:133299678-133299700 GGGTTGGGGAGCCGTCCTGGTGG - Intronic
1077247881 11:1548038-1548060 CGGTGGGGGCGGCGTCCTGGGGG - Intergenic
1077251924 11:1564555-1564577 GGGTGGGGGAGGAGGGCAGGAGG - Intronic
1077369779 11:2176044-2176066 GTGCTGGGGAGGAGCCCAGGAGG + Intergenic
1079398835 11:20088983-20089005 CGGTTTGGGAGGTTTGCAGGAGG - Intronic
1081775604 11:45674251-45674273 CAGTCAGGGAGGAGCCCAGGAGG - Intergenic
1082983119 11:59142679-59142701 TGGTTGGGGAGGAGTCGCGGAGG - Intergenic
1084147975 11:67275089-67275111 AGGGTGGGGAGCAGGCCAGGGGG + Intronic
1084476423 11:69392071-69392093 AGGCTGGGGAGGAATCCAGCTGG + Intergenic
1084662866 11:70557462-70557484 CAGTGGGGGAGGAGCCCAGATGG + Intronic
1084787748 11:71453262-71453284 CGCTTGGGCAGGAGGCCAGCGGG - Exonic
1085344505 11:75759358-75759380 CGGTGGGAGAGGAGTGGAGGCGG + Intergenic
1086942116 11:92809227-92809249 TGCTTGGGGAGGAGTCAAGTCGG - Intronic
1087104185 11:94394082-94394104 GGACTGGGGAGGGGTCCAGGAGG + Intronic
1089064497 11:115652265-115652287 ATGTAGGGGAGCAGTCCAGGTGG + Intergenic
1089663883 11:120004586-120004608 CAGTTGGTGAGAAGTGCAGGTGG - Intergenic
1090350148 11:126102798-126102820 TGGGTGGGGAGGAGCCCAGCCGG + Intergenic
1091347417 11:134864582-134864604 TGGTTGGGGAAGGTTCCAGGAGG + Intergenic
1091675601 12:2486809-2486831 AGGTGGGGGAGGAGGGCAGGTGG + Intronic
1092107247 12:5930603-5930625 CACTTGAGGAGGGGTCCAGGGGG - Intronic
1094412590 12:30182844-30182866 CAGTTGGAGAGGAGTTCAGCTGG + Intergenic
1094783278 12:33817956-33817978 CAGTTGGGGAGGGGTACTGGTGG + Intergenic
1096849194 12:54424678-54424700 AGGTTGGGGAGGAAGGCAGGAGG + Intergenic
1097185424 12:57194036-57194058 GCGATGGGGAGGAGCCCAGGAGG - Intronic
1098521736 12:71440655-71440677 CGGTTGGGGCGGGGACCAGATGG - Intronic
1099433229 12:82613964-82613986 AGGTTGGGATGGAGTCAAGGTGG - Intergenic
1100351851 12:93791520-93791542 GGGTTGGGGTGGAGGGCAGGTGG + Intronic
1101421953 12:104557575-104557597 CGGCTGGACAGGAATCCAGGTGG + Intronic
1103020945 12:117533864-117533886 CACATGGGGAGGAGTCAAGGAGG - Intronic
1103156424 12:118689001-118689023 AGGCTGGGGAGGTGGCCAGGTGG + Intergenic
1103795378 12:123499633-123499655 AGGCTGGGGAGGAGGCCGGGGGG - Intronic
1104051321 12:125195757-125195779 GGGTAAGGGAGGAGGCCAGGTGG + Intronic
1104549060 12:129739288-129739310 AGGTGTGGGTGGAGTCCAGGTGG + Intronic
1104954610 12:132458030-132458052 CGGGTGGGTAGGTGACCAGGTGG + Intergenic
1104975260 12:132549308-132549330 CTGTTGGGGACGCGTCCTGGTGG + Intronic
1105522152 13:21140715-21140737 AGGTTGGGGATGAGTCCCGCAGG + Intronic
1105557316 13:21459318-21459340 CGGGACGGGAGGAGTCCCGGCGG - Exonic
1107846676 13:44521440-44521462 ATGAAGGGGAGGAGTCCAGGAGG - Intronic
1107991511 13:45822844-45822866 AGGCTGGGGAGGAGGCCATGGGG - Intronic
1109915921 13:68984887-68984909 CTGGAGGGGAGGAGTCCAGGCGG + Intergenic
1111311958 13:86501141-86501163 CTGTTGGTGAGAAATCCAGGAGG + Intergenic
1113586266 13:111468183-111468205 AGGTGGGAGAGGAGTCAAGGGGG + Intergenic
1114484397 14:23054412-23054434 TGGCTGGGGAGGAGGCGAGGAGG + Intronic
1117388546 14:55240988-55241010 GGGTTGGGGCGGAATGCAGGAGG + Intergenic
1119189431 14:72670361-72670383 CGGAGGAGGAGGAGCCCAGGAGG + Exonic
1119327860 14:73772222-73772244 TGGGTGGGAAGGAGGCCAGGGGG - Intronic
1119578829 14:75755870-75755892 AGGTCGGGGAGGAGTCAAGAAGG - Intronic
1119773425 14:77235419-77235441 GGGTGGGGAAGGTGTCCAGGGGG + Intronic
1119773482 14:77235595-77235617 GGGTGGGGAAGGTGTCCAGGGGG + Intronic
1119773599 14:77235928-77235950 GGGTGGGGGAGGTGTCCAGGGGG + Intronic
1120178973 14:81324080-81324102 AGGGTGGCGAGGGGTCCAGGCGG + Intronic
1121198256 14:92094898-92094920 TGGATGAGGAAGAGTCCAGGAGG + Intronic
1121512554 14:94523179-94523201 CATTTGGGGAGGTGTCCAGGTGG - Intergenic
1122289708 14:100673866-100673888 AGGTTGGGGTGGAGGCCTGGAGG - Intergenic
1122316374 14:100828057-100828079 TGGCTGGAGAGGCGTCCAGGGGG + Intergenic
1122748745 14:103917579-103917601 CGGTGGGGGAGGAATCGAAGGGG - Intronic
1122937399 14:104966532-104966554 AGGTTGGGGGTGCGTCCAGGTGG - Intronic
1123987654 15:25659337-25659359 CGGGTGGGGAGGCCTCCAGAGGG - Intergenic
1124286370 15:28403201-28403223 CGGCAGGGGAGGAGGCCTGGCGG + Intergenic
1124296333 15:28508435-28508457 CGGCAGGGGAGGAGGCCTGGCGG - Intergenic
1125929387 15:43589757-43589779 GGGTGGGGCTGGAGTCCAGGAGG - Intronic
1125942554 15:43689589-43689611 GGGTGGGGCTGGAGTCCAGGAGG - Intergenic
1130043921 15:80429635-80429657 CGGTTGGTGAGAAGTGTAGGAGG + Intronic
1130285316 15:82549822-82549844 CAGTTGGGGTGGAGTCAGGGTGG - Intronic
1132353379 15:101154454-101154476 GGGTTGGTGAGGAGTGCAGATGG + Intergenic
1132703276 16:1230976-1230998 GGGTTGGGGGTGAGTCCATGGGG - Intergenic
1133014458 16:2933075-2933097 GGGGTGGAGAGGAGCCCAGGAGG - Intronic
1134202504 16:12210590-12210612 CGGCAGTGGAGGAGTCCAGAGGG - Intronic
1135491765 16:22915534-22915556 CCGTTGGGCAGGACTTCAGGTGG + Exonic
1136580457 16:31148398-31148420 CGGCTGGGGAGACGTCCAGGAGG - Exonic
1136850916 16:33611706-33611728 CGGATGATGTGGAGTCCAGGAGG - Intergenic
1137587762 16:49674363-49674385 CGGCTGGGGAGCAGTCCAGTCGG + Intronic
1139354819 16:66361212-66361234 TGGCTGGGGAGGAGGCCAGGTGG - Intergenic
1139478323 16:67214387-67214409 CGGGAAGGGAGGAGACCAGGGGG - Intronic
1141964790 16:87434599-87434621 CGGTGGTGCAGGAGACCAGGCGG - Intronic
1142051863 16:87964421-87964443 CCGTTGCCGAGGCGTCCAGGAGG + Intronic
1203112519 16_KI270728v1_random:1460163-1460185 CGGATGACGTGGAGTCCAGGAGG - Intergenic
1145059139 17:19721258-19721280 CAGTTGAGGAGGAGTGGAGGAGG - Intergenic
1146567281 17:33924251-33924273 GGGTTGGGGAGAACCCCAGGAGG - Intronic
1147169443 17:38609417-38609439 GGGTGGGGGAGGAGCCAAGGAGG + Intergenic
1147371827 17:39997736-39997758 CGGCTGGGGAGGAGCCCTGGGGG - Exonic
1148795328 17:50194232-50194254 AGGTGGGGGAGGACTCCAGAGGG + Intronic
1152563565 17:81090359-81090381 CGGATGGGGAGGAGCAGAGGCGG - Intronic
1152657358 17:81526194-81526216 AGGCTGAGGAGGAGCCCAGGCGG - Intergenic
1153978441 18:10289613-10289635 CGGTTGGGGATAAGTGCTGGGGG - Intergenic
1155002740 18:21703368-21703390 CGGTTAGGGCGGGGACCAGGAGG + Intronic
1158768030 18:60479207-60479229 GTGTTGGGGATGAGGCCAGGTGG - Intergenic
1160809890 19:1008815-1008837 CGGTTGGCGAGGAGGCGGGGGGG - Intronic
1160856191 19:1219021-1219043 TGCTTGGGGGGGCGTCCAGGAGG + Intronic
1161063827 19:2228007-2228029 CGTTGGGGGAGGAGGCAAGGCGG - Intronic
1161365540 19:3877268-3877290 CCGTTGGGGAGGTTTCCTGGTGG - Intergenic
1161702699 19:5804172-5804194 CCGTCGGGGAGGAGCCCGGGTGG + Intergenic
1161766421 19:6211330-6211352 CAGGTGGCGAGGAGTCCCGGAGG + Intergenic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1163281310 19:16319706-16319728 CGTCTGGGGAGGAAGCCAGGCGG + Intergenic
1164840023 19:31386299-31386321 CATTTGGGGAGGAGCCCAGCTGG - Intergenic
1165118117 19:33541360-33541382 TCTTTGGGGAGGAGGCCAGGAGG - Intergenic
1165829579 19:38723853-38723875 GGGGTGGGGAGGGGTCCAGAGGG - Intronic
1166382379 19:42361827-42361849 CGGTCAGGGAGAAATCCAGGAGG + Intronic
1166667472 19:44689622-44689644 GGAGTGGGGAGGAGTCCAGGCGG - Intergenic
1166750540 19:45162228-45162250 CGTTTGGGGAGTGGGCCAGGCGG + Intronic
1167602364 19:50461759-50461781 GGGGAGGGCAGGAGTCCAGGTGG - Intronic
1167649928 19:50723618-50723640 AGGCTGGGGAGGTGCCCAGGAGG + Exonic
1167713403 19:51125733-51125755 GGGTGGTGGAGGGGTCCAGGGGG - Exonic
1168044794 19:53786862-53786884 GGCTTGGGGCGGAGACCAGGGGG + Intergenic
1168147614 19:54428861-54428883 CGGGTGGGGAGGGGTGCAGGGGG - Intronic
1168401431 19:56088006-56088028 CGGTAGGGGAGGGGCCCGGGGGG - Exonic
926695901 2:15770165-15770187 GTGTTTGGGAGGACTCCAGGAGG - Intergenic
930946809 2:57084953-57084975 CAGTTGGGGAGCAGTGCAGTCGG - Intergenic
931020918 2:58044714-58044736 AGGTTGGAGAGTGGTCCAGGTGG + Intronic
936715392 2:115181353-115181375 CTGTTGGTCAGGAGTTCAGGTGG + Intronic
937039520 2:118810063-118810085 AGGTTGGGGAGGAGTCAGGAAGG - Intergenic
937463596 2:122110362-122110384 CGGTGGAGGAGGTGTACAGGTGG + Intergenic
939529903 2:143345459-143345481 GGGTTGGGGTGGGGTTCAGGTGG - Intronic
942135100 2:172917496-172917518 GGGTTGGGGAGGGGTGCAGGGGG + Intronic
946085924 2:217171450-217171472 GGAGTGGGGAGGAGCCCAGGTGG - Intergenic
946100422 2:217315754-217315776 CAGTTGGAGAGGAGTTCAGCTGG + Intronic
946409331 2:219508576-219508598 GGGTTGGGGAGGAGTGGGGGGGG - Intergenic
948133975 2:235621850-235621872 CAGTTGGGTAGGAGTGGAGGAGG + Intronic
948384745 2:237574583-237574605 GGGTTGGGGAGCAGGCCAGATGG - Exonic
948847519 2:240690257-240690279 GGGTTGGGGAGGGGGACAGGCGG + Intergenic
949005162 2:241641819-241641841 CGGGTGTGGAGAGGTCCAGGAGG + Intronic
1172443407 20:34980742-34980764 CGGTTGGGGAGGAGTCCAGGCGG - Intronic
1172973239 20:38888574-38888596 CCGTGGATGAGGAGTCCAGGGGG - Intronic
1173222356 20:41140400-41140422 TGCTTGGGCAAGAGTCCAGGTGG - Intronic
1175953101 20:62593854-62593876 AGGCTGGGCAGGAGACCAGGTGG - Intergenic
1176090835 20:63317980-63318002 AGGTTGGGGAGGCACCCAGGAGG - Intronic
1176222891 20:63978535-63978557 GGGTTGGGGATGTGTCTAGGAGG + Intronic
1179232644 21:39519155-39519177 CAGTTGGGGAGGGGCTCAGGTGG + Intergenic
1179983785 21:44910254-44910276 CAGGTGGGGAGGGGTCCAGGAGG + Intronic
1182074029 22:27482717-27482739 AGGCTGCAGAGGAGTCCAGGAGG + Intergenic
1183322520 22:37173755-37173777 GGGTTGGGGAGGGGTCCTGGAGG + Intronic
1183369815 22:37426147-37426169 CTGGGTGGGAGGAGTCCAGGGGG + Intronic
1184160132 22:42692862-42692884 AGGTTGGGGAGGTGACCTGGCGG + Exonic
1184308340 22:43624432-43624454 TGGTTGGGGAGGAGGCCAGGAGG - Intronic
1184936241 22:47724392-47724414 CAGTTGGGGATGAGACCAGTTGG - Intergenic
1184978056 22:48077090-48077112 GGGTAAGGGAGGAGTTCAGGTGG - Intergenic
1185244568 22:49766109-49766131 GGGATGGGGAGGAGCCCAGTGGG + Intergenic
950008365 3:9705307-9705329 CTTTTGGGGAGGAGTCAGGGTGG - Intronic
950453789 3:13080488-13080510 CCCCTGGGGAAGAGTCCAGGAGG + Intergenic
952039219 3:29241378-29241400 CGGTGGGAGAGGAGTTCAGCTGG - Intergenic
953331524 3:42057485-42057507 GGGTTGAGGAGGCGTCCAGTGGG + Intronic
954864680 3:53718557-53718579 GGGGTGGGGAGGTGTGCAGGAGG - Intronic
958450738 3:94269482-94269504 CAGTTGGGAAGGAGTCTGGGAGG + Intergenic
961349816 3:126292679-126292701 CAGTGGGGGAGGTGTCCATGGGG + Intergenic
963835944 3:150057866-150057888 TGGCTGGGGAAGAGACCAGGAGG + Intergenic
966002805 3:174971171-174971193 CGTTTTGGGAGGAACCCAGGAGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
966871463 3:184292616-184292638 AGCCTGGGGAGAAGTCCAGGAGG - Exonic
968085594 3:195872599-195872621 CTGTTGGGGAGGAGGGCCGGTGG - Intronic
968465773 4:749905-749927 GGCTTGGGCAGGAGCCCAGGAGG - Intronic
968545350 4:1195173-1195195 CGGTGGGGGCAGAGCCCAGGAGG - Intronic
968565625 4:1311083-1311105 CGGCTGGAGAGGAGGCGAGGTGG + Intronic
968853650 4:3102131-3102153 CAGGTGGGAGGGAGTCCAGGTGG + Intronic
970413884 4:15837469-15837491 GGGTTGGGGAGGCCTCCTGGAGG + Intronic
973726623 4:53783368-53783390 CTGCAGGGGAGGATTCCAGGAGG + Intronic
976538389 4:86243854-86243876 TGGTTGGGGAGGAGCTCGGGAGG - Intronic
981279172 4:142937120-142937142 AGGTTGGGGAGGAGGAGAGGAGG + Intergenic
982010338 4:151099795-151099817 CGGATGGCGAGGATTCCAGTCGG + Intronic
984768765 4:183419719-183419741 CGGTTGTGGTGGGGTCGAGGAGG - Intergenic
987599404 5:20046331-20046353 CAGTTGGGGAGAAGTCCATTGGG + Intronic
989633556 5:43511423-43511445 CGGTTGGGGCGGCGGCCGGGCGG - Intronic
989828987 5:45891005-45891027 CGGATGGGGTGGCGGCCAGGCGG - Intergenic
990345036 5:54863487-54863509 GGGATGGGGAGTTGTCCAGGAGG - Intergenic
991508361 5:67350064-67350086 CTGTGGGGAAGGAGTCCAGCTGG - Intergenic
992443920 5:76818183-76818205 GGGTTGGGGATGAGTGCATGAGG - Intergenic
994167753 5:96625908-96625930 GGGTTGATGGGGAGTCCAGGAGG - Intronic
994676008 5:102822898-102822920 TGAGTGGGGAGGAATCCAGGTGG - Intronic
996890347 5:128411513-128411535 CGGTTGGAGAGGAGTTCAGCTGG - Intronic
997627272 5:135339573-135339595 CGGCTGGGGAGGAGTAGAGGTGG + Intronic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
998570193 5:143250217-143250239 TGGTTGGGGTGGAGGCCAGCAGG - Intergenic
999143367 5:149377301-149377323 GGGGTGGGAAGGTGTCCAGGAGG - Intronic
1000340794 5:160275758-160275780 GGGTTGGGGAGAAAGCCAGGAGG - Intronic
1000889036 5:166782361-166782383 CTGGTGGGGGGGAGTCCTGGGGG - Intergenic
1002644207 5:180645274-180645296 CCGTGGGGGTGGAGACCAGGAGG + Intronic
1002926633 6:1609210-1609232 CGGCTGGGGAGGGGTCATGGAGG + Intergenic
1003062899 6:2876243-2876265 CAGGTGGGGAGGACTCCCGGTGG + Intergenic
1006388019 6:33742856-33742878 GGTCTGGGAAGGAGTCCAGGAGG + Intronic
1006421002 6:33934098-33934120 CGGTTGGTCAGAAGTACAGGTGG - Intergenic
1006456862 6:34136941-34136963 GGGTTGGGGTGGGGGCCAGGCGG + Intronic
1007098634 6:39229543-39229565 CGACCGGGGAGGAGCCCAGGCGG + Intergenic
1007101848 6:39253966-39253988 GGGGAGGGGAGAAGTCCAGGAGG + Intergenic
1007106271 6:39285227-39285249 AGGTTGGGGATGGGACCAGGAGG + Intergenic
1007139311 6:39555213-39555235 GGCTTGGGGAGGGCTCCAGGAGG - Intronic
1013119118 6:107125887-107125909 GGGTTGGGGAGGACTCCAAAAGG - Intergenic
1017019512 6:150129043-150129065 CAGCTGGGGAGGTGTCCTGGGGG + Intergenic
1018048780 6:159989296-159989318 GGGTTGGGGAGGAGGGCACGTGG + Intronic
1018730665 6:166647413-166647435 AGATTGGGGAGGAATCCTGGAGG - Intronic
1019261866 7:86355-86377 AGGCTGGGGAGGAGCTCAGGAGG - Intergenic
1019335587 7:481077-481099 AGGGCAGGGAGGAGTCCAGGTGG + Intergenic
1019595637 7:1857124-1857146 CTGTTGGTGAGGAGTCCTGGAGG - Intronic
1020007411 7:4789971-4789993 GAGAGGGGGAGGAGTCCAGGAGG - Intronic
1021500908 7:21330609-21330631 CGGTGGGGGAGCAGTGCAGTTGG - Intergenic
1023401671 7:39796022-39796044 CAGTTGGGGGGCAGTCCAGTGGG - Intergenic
1023803148 7:43852196-43852218 GGGTTGGGCAGGGGTCTAGGTGG + Intergenic
1024647949 7:51384653-51384675 CAGTTGGGGGGCAGTCCAGTGGG + Intergenic
1025128762 7:56364820-56364842 CAGTTGGGGGGCAGTCCAGTGGG + Intergenic
1026724481 7:72859940-72859962 CGGTTGGTGAGAAGTACATGTGG + Intergenic
1027236664 7:76302543-76302565 CGCTGGGGGAGGAGTGCATGGGG + Exonic
1028405429 7:90468954-90468976 TGGTTGGGGAGGGGTAGAGGTGG - Intronic
1031484066 7:122307317-122307339 CGGTGGCGGAGGAGTGCAGCAGG - Intronic
1032263023 7:130351676-130351698 ATGATGGGGAGGGGTCCAGGAGG + Intronic
1032415677 7:131733599-131733621 CTGTTGGGGAGGAGGCCTGCAGG + Intergenic
1034529471 7:151686638-151686660 GGGGTGGGGAGGACACCAGGCGG - Intronic
1034781492 7:153886538-153886560 CGGCTGGGGCGGAGGCCCGGAGG + Intergenic
1035351788 7:158252461-158252483 GGGTTGGTGAGCACTCCAGGCGG + Intronic
1035450624 7:158974636-158974658 CGGGTGGGGAGGAGCCCGCGGGG + Intergenic
1036561368 8:9902873-9902895 GGTTTGGGGAGGAGGGCAGGCGG - Intergenic
1036673333 8:10807827-10807849 AGGCTGGGGAAAAGTCCAGGAGG + Intronic
1038147673 8:24913634-24913656 CGGTCGGGGAGGAGGGGAGGGGG - Exonic
1038150874 8:24941881-24941903 CGGTTGGGTGGGAGCCCTGGCGG + Intergenic
1038372352 8:27006833-27006855 GGGGTGGGGAGGAGGCCTGGAGG + Intergenic
1038447049 8:27611545-27611567 TGGTGGGGGTGGAGTGCAGGGGG - Intronic
1040060226 8:43097375-43097397 TGGATGGGGAGGAGTCCAGAGGG + Intronic
1044539146 8:93390566-93390588 GGATTGCGGAGGACTCCAGGTGG - Intergenic
1045431396 8:102118190-102118212 CTGGTGGGGAGGCATCCAGGTGG - Intronic
1045930848 8:107624669-107624691 CGATTTGGGAGGAGTGGAGGTGG - Intergenic
1048287118 8:133150517-133150539 CTGTTGGGGAAGAGTCATGGTGG - Intergenic
1048881940 8:138878263-138878285 CGCTGGAGGAGGTGTCCAGGAGG + Exonic
1048999790 8:139817537-139817559 CTGTGGGGCAGGAGACCAGGAGG - Intronic
1049016636 8:139924649-139924671 GGGATGGGGAGAAGTCCAGGTGG - Intronic
1049224252 8:141442026-141442048 TGCTTGGGCAGGAGACCAGGGGG + Intergenic
1049433108 8:142574343-142574365 AGGTGGGGGATGAGACCAGGCGG - Intergenic
1050182264 9:2934159-2934181 AAGTTGGGGCCGAGTCCAGGCGG + Intergenic
1053004100 9:34593082-34593104 GGGTTGGGGCGGGCTCCAGGAGG + Intergenic
1056123115 9:83509014-83509036 AAGTTGGGGAGGAGGCAAGGAGG - Intronic
1056733015 9:89181987-89182009 GGGTTGGTGAGGAGGTCAGGAGG + Intergenic
1057695804 9:97322254-97322276 GGGCTGGGGAGGAGGGCAGGGGG - Intronic
1058632958 9:107008150-107008172 CAGTTGGGGAGGAGTCAGGAAGG + Intronic
1058779080 9:108315460-108315482 CTGATGGGCAAGAGTCCAGGTGG + Intergenic
1058833231 9:108837887-108837909 CGGTTGGTCAGAAGTGCAGGTGG + Intergenic
1061139005 9:128753098-128753120 CAGGTGGGGAGGAGTAGAGGTGG - Intronic
1062000087 9:134211517-134211539 TGGCTGGAGAGAAGTCCAGGCGG + Intergenic
1062390379 9:136331413-136331435 AGGCTGGGGAGGGGGCCAGGTGG + Intronic
1185672722 X:1825271-1825293 GTGTTGGGGATGAGGCCAGGTGG - Intergenic
1186717613 X:12269215-12269237 AGTTTGGGGAGAAGCCCAGGAGG + Intronic
1187673577 X:21692667-21692689 CTGTGGGTGAGAAGTCCAGGTGG - Intergenic
1189029964 X:37440359-37440381 CGATTTGGGAGGAGTATAGGAGG + Intronic
1190062715 X:47221535-47221557 AGGATGGGGAGGAAGCCAGGAGG - Intronic
1191092237 X:56635703-56635725 CGGGTGGGGAGGAGCCAAGATGG - Intergenic
1192530178 X:71876846-71876868 CGGATGGGGCGGCGGCCAGGCGG + Intergenic
1196873687 X:120137131-120137153 CGGTGGGGGAGAATTCCAGAGGG + Intergenic
1197952057 X:131908231-131908253 GGGTTGGGGCGGAGCCCGGGGGG + Intergenic
1198841796 X:140865217-140865239 CGGTTGGGGGAGGTTCCAGGCGG - Intergenic
1198935756 X:141901703-141901725 AGGATGAGGAGCAGTCCAGGAGG - Intergenic
1199559943 X:149151526-149151548 TGGTTGGAGAGGAGTCCACTGGG + Intergenic
1199762176 X:150913324-150913346 GGGCGGGGGAGGTGTCCAGGAGG - Intergenic