ID: 1172445664

View in Genome Browser
Species Human (GRCh38)
Location 20:34992038-34992060
Sequence GTGTCCACTTAGAAGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 97}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172445655_1172445664 5 Left 1172445655 20:34992010-34992032 CCCACCTGACCCACACAGCCCTG 0: 1
1: 0
2: 4
3: 37
4: 424
Right 1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1172445659_1172445664 -5 Left 1172445659 20:34992020-34992042 CCACACAGCCCTGTGCATGTGTC 0: 1
1: 0
2: 8
3: 33
4: 311
Right 1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1172445656_1172445664 4 Left 1172445656 20:34992011-34992033 CCACCTGACCCACACAGCCCTGT 0: 1
1: 0
2: 4
3: 50
4: 458
Right 1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1172445654_1172445664 25 Left 1172445654 20:34991990-34992012 CCTTCACAGCGTGGCTGTAGCCC 0: 1
1: 0
2: 0
3: 12
4: 108
Right 1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1172445658_1172445664 -4 Left 1172445658 20:34992019-34992041 CCCACACAGCCCTGTGCATGTGT 0: 1
1: 1
2: 3
3: 21
4: 247
Right 1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 97
1172445657_1172445664 1 Left 1172445657 20:34992014-34992036 CCTGACCCACACAGCCCTGTGCA 0: 1
1: 1
2: 3
3: 40
4: 432
Right 1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG 0: 1
1: 0
2: 1
3: 11
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172445664 Original CRISPR GTGTCCACTTAGAAGTGGGC AGG Intronic
900732535 1:4271717-4271739 TGGTCCAGTTAGATGTGGGCGGG + Intergenic
905300448 1:36983023-36983045 GTGTGCAATAAGAAGAGGGCTGG - Intronic
905500845 1:38435065-38435087 CTGTGCATTGAGAAGTGGGCTGG - Intergenic
910259724 1:85283726-85283748 CTGCCAACTTGGAAGTGGGCAGG - Intergenic
915762520 1:158329475-158329497 ATGTCCAGTTAGCATTGGGCAGG + Exonic
917772276 1:178292627-178292649 GTGCCCTCTTTGAACTGGGCTGG - Intronic
922345307 1:224691400-224691422 TTGTCCACTGCAAAGTGGGCAGG + Intronic
922361741 1:224828864-224828886 GTCTGTACTTAGAAGTTGGCAGG + Intergenic
924722791 1:246638800-246638822 GTGTCCACACAGAAGTGTGCAGG + Intronic
1064533568 10:16334840-16334862 GTGTGCATTTGGAAGTGGGCTGG - Intergenic
1066269043 10:33804161-33804183 GAGCCCACTTAGAAGTGGGCAGG - Intergenic
1074771961 10:116740785-116740807 TTGTCAAATCAGAAGTGGGCAGG - Intronic
1078261150 11:9710116-9710138 GGGTCCACTTAAATGTGGACTGG - Intronic
1083320584 11:61843590-61843612 GTGTCCCCTTAGAATTTGTCTGG - Intronic
1083742883 11:64720475-64720497 GGGGCCACTTAGAAATGGGAAGG + Intronic
1086135243 11:83438042-83438064 GTGTCCTCTTGGCAGTGGGAAGG + Intergenic
1087048690 11:93865729-93865751 GTGTCTACATAGAAGTGTGCAGG + Intergenic
1088323020 11:108572462-108572484 GTTTCCACTCACAGGTGGGCTGG - Intronic
1091208000 11:133833829-133833851 GTGTCCACTGCGAGGTGGGGTGG - Intergenic
1099861846 12:88231865-88231887 GTGTCTACACAGAAGTGTGCAGG - Intergenic
1100593368 12:96050460-96050482 GTTTTCACTTATAAGTGGGAGGG + Intergenic
1106544767 13:30720920-30720942 GTGCCCACAGAGAAGTGGGAAGG - Intronic
1107960042 13:45549318-45549340 ATGACCACTTAGAAGAGGGAGGG + Intronic
1115438299 14:33402353-33402375 GTGACCACTGAGAAATGGGTTGG + Intronic
1116250017 14:42469913-42469935 CTGTCCACCTAGAAGTGGCATGG + Intergenic
1119932685 14:78563520-78563542 GTGTCCAGTTATCAATGGGCAGG + Intronic
1120689305 14:87575275-87575297 GTTTCCATTTAGAGATGGGCAGG - Intergenic
1121567529 14:94921984-94922006 TTCTCCATTTAGAACTGGGCTGG + Intergenic
1125743943 15:41986491-41986513 GTGCCCGCTTGGAACTGGGCAGG - Intronic
1127069120 15:55270976-55270998 GTGGCCAATTGGAAGTGGGAGGG - Intronic
1130857580 15:87854638-87854660 GTGACTATTTAGAAGAGGGCTGG - Intergenic
1131392071 15:92057762-92057784 TTGTCCACTGAGAAATGGGATGG - Intronic
1132851951 16:2028779-2028801 GTGCCCACTGGGAAGTGGGCAGG - Intronic
1132855310 16:2042312-2042334 GTGTCCACTGAGAGGCTGGCAGG + Intronic
1133576220 16:7093406-7093428 GTGTCAAAGAAGAAGTGGGCTGG - Intronic
1136253681 16:29024272-29024294 GTGTCCTCTGTGAAATGGGCAGG + Intergenic
1137071195 16:35906307-35906329 GTGTCTACACAGAAGTGTGCAGG + Intergenic
1137850444 16:51736709-51736731 TAGTTCACTTGGAAGTGGGCGGG + Intergenic
1141519920 16:84571807-84571829 GTGTCCACTCAGGAGCAGGCTGG - Intronic
1142941237 17:3381392-3381414 GTGTCTGCTTTGAATTGGGCAGG - Intergenic
1146905206 17:36613594-36613616 GTGTACACTGAGAAGGGGCCAGG - Intergenic
1149983546 17:61330445-61330467 GTGTTCACTTTGAATTGGCCTGG + Intronic
1152471253 17:80491127-80491149 GTGTCCACTTTGTCCTGGGCAGG + Intergenic
1157486157 18:48088868-48088890 GTGTGGACTTGGCAGTGGGCAGG + Intronic
1158535165 18:58301925-58301947 GTGTGCACTTGGAAGTGTGATGG + Intronic
1159652080 18:70989098-70989120 AAGTTCACTTAGGAGTGGGCAGG - Intergenic
1160045106 18:75379307-75379329 GTGTACACTTCTAAGTGGGCAGG - Intergenic
1163504902 19:17699893-17699915 GTGGCCACTTAGGCTTGGGCTGG - Intergenic
1168246532 19:55115502-55115524 GTGGCCACTGAGAACCGGGCAGG + Intronic
1168334199 19:55587532-55587554 GTGCCTGCTTCGAAGTGGGCGGG + Intergenic
1168467831 19:56618560-56618582 GTGTTCATAAAGAAGTGGGCAGG + Intronic
925254103 2:2467555-2467577 GTGTCTACTGAGCAGTGGTCAGG - Intergenic
927697947 2:25250804-25250826 GTGTGCAGGTAGCAGTGGGCGGG + Intronic
939518019 2:143193259-143193281 GTGCCCACTCACAAGTTGGCTGG - Intronic
942183440 2:173402347-173402369 GAGTCCAATTAGATCTGGGCTGG + Intergenic
946386120 2:219385574-219385596 GAGTCCCCTGAGAAGTGGGGAGG - Intronic
948454434 2:238098228-238098250 GTGTCCCCTTCGACGTGGCCAGG + Exonic
948609528 2:239157966-239157988 GTGTGCCCTGAGCAGTGGGCGGG - Intronic
1172299368 20:33838340-33838362 GTGTCCAGGTAGAAGTTGGTGGG + Intronic
1172445664 20:34992038-34992060 GTGTCCACTTAGAAGTGGGCAGG + Intronic
1177994343 21:28077114-28077136 GTATCAACCTAGAAATGGGCTGG + Intergenic
1178425676 21:32477147-32477169 GTGTCCACTCACAGGTGAGCTGG + Intronic
1179251629 21:39675520-39675542 GTGTCCAGTAAAATGTGGGCAGG - Intergenic
1179667149 21:42920791-42920813 GTGTCCACACAGAAGTGTGCAGG + Intergenic
1179810998 21:43869679-43869701 GGGTCCACTTGGCACTGGGCTGG - Intronic
1181414697 22:22750860-22750882 GTGTCCAATGAGAAGTGGACAGG + Intronic
1185250604 22:49799694-49799716 CTGTCCACTGAGAAGGGAGCAGG - Intronic
950107295 3:10396414-10396436 GTTTCAGCTTAGAAGAGGGCAGG - Intronic
955947897 3:64212955-64212977 GTGTACACTTAAAGGTGTGCTGG + Intronic
959841892 3:110985794-110985816 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
960807974 3:121602269-121602291 GTATCCACTTACAAGTGAGAGGG - Intronic
963952482 3:151218237-151218259 GAATCAACTGAGAAGTGGGCAGG - Intronic
967799217 3:193636681-193636703 GTATCCACTGACAACTGGGCAGG - Intronic
970337864 4:15070582-15070604 GTGTCTACTTTGAAGAGGGAGGG + Intergenic
970444983 4:16116011-16116033 GTGTCCAGTTAGAAAGGGGAAGG - Intergenic
970961212 4:21872927-21872949 GATTCCACTTGGAAGTGGTCTGG + Intronic
972245980 4:37245408-37245430 GTGTCCTAATAGAAGTGTGCAGG - Intronic
974867745 4:67601690-67601712 GTTTCCACTGAGAAGTCTGCTGG + Intronic
981837117 4:149066780-149066802 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
983491726 4:168397832-168397854 CTGTCAACTCAGAAGTGGGCAGG - Intronic
985296365 4:188441221-188441243 GTGTCCACTTTAAAGTGTGTTGG + Intergenic
992002980 5:72453137-72453159 GTTTCCACTGAGCACTGGGCTGG + Intronic
994963580 5:106637590-106637612 GAGTCCAATTAGAAGAGGTCAGG + Intergenic
998260397 5:140626577-140626599 GTGGCTGCTTAGAAGTGGGGTGG - Intergenic
1001412768 5:171522522-171522544 GTGACCACTTAGAAGGTGGCTGG + Intergenic
1003369103 6:5507704-5507726 GAGGCCACTGAGAGGTGGGCTGG - Intronic
1010252921 6:73727096-73727118 GTGTCCACTCTGCTGTGGGCAGG + Intronic
1012407857 6:98921542-98921564 GTTTCCAATTAGAGATGGGCTGG - Intronic
1017409938 6:154157236-154157258 GTGGCCACTAAGACGTGGGTGGG - Intronic
1023642307 7:42272150-42272172 GTTGCCCCTTAGGAGTGGGCAGG + Intergenic
1024786347 7:52911634-52911656 CTGCCAACTTAGAAGCGGGCAGG + Intergenic
1025154631 7:56593368-56593390 GTGTGCCCTTAGAAATGGGGAGG - Intergenic
1026870544 7:73848597-73848619 GTGTCCATTTTGATGTGTGCAGG + Intergenic
1033762860 7:144455243-144455265 GTTTCCACTTTAAAGTTGGCAGG - Intronic
1033910240 7:146254535-146254557 GTGTCCTATTAGAAGTGTTCAGG + Intronic
1035420221 7:158723632-158723654 GTGTGGACTTGGAGGTGGGCTGG + Intergenic
1036101308 8:5788788-5788810 GTCTCCACAAGGAAGTGGGCAGG + Intergenic
1038613095 8:29071652-29071674 GTGCCCTCTTGGAAGTCGGCAGG + Exonic
1040898378 8:52391706-52391728 GTGTCCACTTTGATGTTTGCAGG + Intronic
1041279938 8:56199109-56199131 GTGTACACTGAGAAGTGGACTGG + Intronic
1045547479 8:103141192-103141214 CTGTCCACTGATCAGTGGGCAGG - Intronic
1049236418 8:141514581-141514603 GCCTCCACTCAGGAGTGGGCTGG - Intergenic
1057040210 9:91842582-91842604 GTGGACAATTGGAAGTGGGCTGG - Intronic
1057123951 9:92601667-92601689 GTGCCCACAGAGGAGTGGGCTGG + Intronic
1061462319 9:130750247-130750269 GTATATACTTAGAGGTGGGCTGG + Intronic
1186365553 X:8889269-8889291 GTGTCCACTTGCAAGTGATCTGG + Intergenic
1187623770 X:21087585-21087607 GTTTCCACTGAGAAGTCTGCTGG - Intergenic
1189680833 X:43514131-43514153 CTGCCAACTAAGAAGTGGGCAGG + Intergenic
1192945924 X:75965575-75965597 GTGTCCACGAAGAAGTGTGCAGG + Intergenic
1197189590 X:123631124-123631146 GTGTTCACTTAGCACAGGGCAGG + Intronic