ID: 1172452586

View in Genome Browser
Species Human (GRCh38)
Location 20:35038028-35038050
Sequence CAGAGAAAAAAGCAGAATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 2, 2: 5, 3: 98, 4: 825}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172452586 Original CRISPR CAGAGAAAAAAGCAGAATGG TGG Intronic
900161424 1:1225815-1225837 CAGAGCAAAAAGCAAAAAGGTGG + Intronic
901411269 1:9085891-9085913 CAGGGAGAAAAGCTGAAGGGAGG + Intronic
901598208 1:10401629-10401651 CAGAGAAAACTGAAAAATGGTGG + Intronic
901660428 1:10795332-10795354 CAGAGAAAAAAGTAGTTTGTGGG - Intronic
901775692 1:11559139-11559161 CAAAGGAGAAAGCTGAATGGTGG - Intergenic
901924687 1:12558630-12558652 CAGAGACAGAAGTAGATTGGGGG + Intergenic
902112955 1:14098551-14098573 CAGAAATATAAGAAGAATGGAGG - Intergenic
902218312 1:14948708-14948730 CAGAGAAAGCAGTAGCATGGAGG + Intronic
902220571 1:14961936-14961958 CAGGGAAAGAGCCAGAATGGAGG + Intronic
902574029 1:17365874-17365896 AAAAAAAAAAAGTAGAATGGTGG + Intergenic
902801523 1:18832978-18833000 CAGAAAAAAAAAAAGAGTGGGGG - Intergenic
903577019 1:24345360-24345382 CAGGGAGAAAAGCAGGCTGGGGG - Intronic
903847529 1:26287378-26287400 CAGACAACAGAGCAGAAAGGTGG + Intronic
904100828 1:28025691-28025713 CAGATAACAAATAAGAATGGTGG + Intronic
904757248 1:32774696-32774718 CAGAGGACAAAGGAGAAGGGAGG + Exonic
905604370 1:39284386-39284408 GAGAGAAAAAGGAAGAATTGAGG + Exonic
905642168 1:39597745-39597767 CAGAGACAGAAGCAGATTAGTGG + Intergenic
905654052 1:39674696-39674718 CAGAGAGAGAAGCAGAAGGAGGG + Intergenic
905944065 1:41887198-41887220 CAGGGAAAAAAGTATTATGGAGG + Intronic
906568949 1:46820147-46820169 CAGAGAACAAAGGACAGTGGGGG - Intergenic
906626780 1:47332132-47332154 CAAAAGAAAAAGGAGAATGGGGG + Intergenic
906788828 1:48640971-48640993 TAGAGAAAAAGGCAGCTTGGCGG + Intronic
906797588 1:48710375-48710397 CAGAGAGAAAAGCCTAAAGGTGG + Intronic
907241460 1:53083563-53083585 CAGAGAAAACGGAAGACTGGAGG - Intronic
907665540 1:56431184-56431206 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
907855850 1:58302978-58303000 CTGTGATAAAAGCAGAATAGAGG - Intronic
908623801 1:66016984-66017006 CAGAGAAAACAACAGAGTGTGGG + Intronic
908832833 1:68197843-68197865 AAGAGAAAAGAGCTAAATGGAGG + Intronic
909268769 1:73596705-73596727 TTGAAAAAAAATCAGAATGGTGG + Intergenic
910241667 1:85093273-85093295 AAGAGAAAAAAACATCATGGTGG - Intronic
910606600 1:89092104-89092126 CAGAGGAAAAAGAAAATTGGAGG + Intergenic
911402004 1:97386969-97386991 AAGAAAAAAAACCAGAATGATGG + Intronic
911413906 1:97546611-97546633 CTGAGGAAAAACAAGAATGGTGG + Intronic
911433764 1:97828005-97828027 TAGAGAACAGAGCTGAATGGTGG + Intronic
911758743 1:101591408-101591430 CAGAGAAAACAGTTGAATGAAGG - Intergenic
911895106 1:103423435-103423457 CAGAGAAAAGTGCAGTTTGGAGG + Intergenic
912863499 1:113236367-113236389 CAGAGAAAATAGTACAATGAAGG - Intergenic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913088835 1:115462367-115462389 GAGAGAAGAAAGAATAATGGTGG - Intergenic
913196344 1:116459439-116459461 AAGAGATAGAAGTAGAATGGTGG + Intergenic
914442740 1:147721579-147721601 CAGATAAATTAGCAGCATGGAGG + Intergenic
914522484 1:148430302-148430324 AAGAGAAACAAAGAGAATGGTGG + Intergenic
915075567 1:153306036-153306058 CAGCGACAACAGCAGGATGGTGG + Intronic
915170439 1:153973615-153973637 CAGGGAAAAAAGAAGAATCTGGG - Exonic
915614886 1:157029951-157029973 TAGAGAAAAAAGTAGATTAGTGG + Intronic
915700004 1:157783072-157783094 GAGAGAAGAAAGAAGAAAGGAGG - Intergenic
916485851 1:165257828-165257850 TAGACAAAAAAGCAGAAGGATGG + Intronic
916860585 1:168800369-168800391 CAAAGAAAAATACAGAATGAGGG + Intergenic
916989989 1:170232631-170232653 CAGAGCAGAAGCCAGAATGGTGG + Intergenic
917343856 1:174008428-174008450 CAGAGGAAGAAGCAGAAGAGGGG + Intronic
917620633 1:176792039-176792061 CAGAGAATGAAGTAGAATGGAGG - Intronic
917659087 1:177160248-177160270 TGGAGAAAACAGAAGAATGGGGG - Intronic
917830043 1:178873014-178873036 ATGAGGAAAAAGAAGAATGGTGG + Intronic
917929146 1:179812000-179812022 CAGCGAAGAAAGCAAAATGAGGG + Intronic
918079165 1:181192389-181192411 CAGAGAAAAGAGCTGCAGGGAGG + Intergenic
918224580 1:182469964-182469986 TAGAGAAAGAAGTAGAATGGTGG + Intronic
918820390 1:189247374-189247396 AAGACAATATAGCAGAATGGTGG - Intergenic
919008412 1:191928950-191928972 GAGAGGAAAAAGAAGAGTGGGGG + Intergenic
919656024 1:200197964-200197986 CTGTGAAAAATGCAGAATGTTGG - Intergenic
919721327 1:200839695-200839717 CAGGGAAAAAAGCAGGAGGGAGG + Intronic
919750827 1:201037057-201037079 AAGAGAAAAGAGGAGATTGGAGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
921285896 1:213609056-213609078 CAGAGAAAAAATTGAAATGGAGG + Intergenic
921379921 1:214514047-214514069 GAGAGAAAAAAGGAAAATTGAGG - Intronic
921729076 1:218556455-218556477 AAGAAAAAAATGCAGAATGTGGG - Intergenic
921742177 1:218697862-218697884 CATAGAAAATGGCAGAAAGGAGG + Intergenic
921781298 1:219168179-219168201 TAGAAAAAAAAGTATAATGGTGG - Intergenic
921997665 1:221439174-221439196 AAAAGACAAAAGCACAATGGTGG + Intergenic
922433577 1:225581135-225581157 CAGAAAAAAAAGAAAAATGTGGG + Intronic
922481871 1:225944932-225944954 CAGAGAAGATAGCAAAGTGGAGG + Intergenic
922489800 1:226007003-226007025 AAGAGAAGAGAGCAAAATGGGGG + Intergenic
922994081 1:229942192-229942214 CAGATTAAAAAGTAGAATAGAGG + Intergenic
923184298 1:231555363-231555385 GAGACAAGAAAGTAGAATGGTGG + Intronic
923578959 1:235188940-235188962 CACAGAAAAAAGCAAATTAGAGG + Intronic
923707277 1:236354282-236354304 CAGAGAAAATATCAGAATGAGGG + Intronic
923791871 1:237118525-237118547 CAGAGACAACGGTAGAATGGTGG + Intronic
923850308 1:237786812-237786834 CAAAGAAAATAACAGAATAGAGG - Intronic
924652819 1:245946172-245946194 CAGAGAAAAAACCTAAATTGTGG - Intronic
1062966030 10:1608510-1608532 AAGAGAAGGAAGGAGAATGGAGG + Intronic
1063323041 10:5070130-5070152 CAGAGAAAACTGCAGAATTCTGG - Intronic
1063662660 10:8044815-8044837 GAGAGATGAAAGTAGAATGGGGG + Intergenic
1063798788 10:9546192-9546214 CAGAGAGAAAAGCTGAAGGGTGG + Intergenic
1063881699 10:10538362-10538384 CAGAGAGAGATGCAGAAGGGTGG + Intergenic
1064008988 10:11720213-11720235 AAGAGAAAGAAGCAGTCTGGGGG + Intergenic
1064201948 10:13292309-13292331 CCCGGAAGAAAGCAGAATGGTGG + Intronic
1064572164 10:16705056-16705078 CACAGAGATAAGCGGAATGGTGG - Intronic
1067097589 10:43312729-43312751 CAGAGAAAGAAGGAGAACAGGGG - Intergenic
1068000489 10:51328159-51328181 AAAAGTAAAAAGTAGAATGGTGG - Intronic
1068574722 10:58672272-58672294 GAGAGAAGAAAGTAGAATGGTGG - Intronic
1068631905 10:59306882-59306904 CAAACAAAAAAGAATAATGGTGG + Intronic
1068721153 10:60247544-60247566 CGGAGACAAAAGTAGGATGGTGG - Intronic
1068736951 10:60424624-60424646 CAGAAATTAAAGCAGAATTGTGG + Intronic
1068903034 10:62291278-62291300 GAGTGAAAAAAGCAGAATTGTGG + Intergenic
1070553324 10:77508830-77508852 CAGAGACAAAAAGCGAATGGTGG - Intronic
1070645856 10:78202022-78202044 CAGAGAAAAGAGCTGAAGGACGG + Intergenic
1070899112 10:80012544-80012566 CAGAACAGAAAGTAGAATGGTGG + Intergenic
1070991170 10:80733352-80733374 AAAAAAAAAAAGCAAAATGGTGG + Intergenic
1071456765 10:85857197-85857219 CAGACAACTAAGCAGAAGGGTGG - Intronic
1072039293 10:91591825-91591847 CAGCGCAGAAGGCAGAATGGAGG + Intergenic
1072206005 10:93205727-93205749 TGGAGAAAAAAGCAAAAAGGAGG + Intergenic
1072214097 10:93273349-93273371 CAGATAAAAAAGCTGAGTTGAGG + Intergenic
1072578372 10:96720244-96720266 CATAGAAAAGAGCAGAAAGAGGG + Intronic
1072957097 10:99896882-99896904 TAGAGATAAAAGTAGAAGGGTGG + Intronic
1074666891 10:115737762-115737784 CTTAGAAAGAAGCAGAATTGGGG - Intronic
1074786995 10:116849924-116849946 CAGAGAAAGTGGCAGAAAGGAGG + Exonic
1075264053 10:120985921-120985943 CATAGAAAGAGGCAGAGTGGTGG - Intergenic
1075576410 10:123580812-123580834 CATTGAAAAATGCAGAAAGGAGG - Intergenic
1075780951 10:125016756-125016778 TAGAGAAGAAAGAAGAGTGGAGG - Intronic
1075911336 10:126127935-126127957 CAGCCAAAAAAACAGCATGGCGG + Intronic
1076225085 10:128768138-128768160 TAGAGTACAAAGCAGAAAGGTGG + Intergenic
1076739254 10:132474018-132474040 CAAAGAAAAAAAGAAAATGGGGG + Intergenic
1076926365 10:133490211-133490233 CACTGAGAAAAGCAAAATGGAGG - Intergenic
1077590022 11:3484088-3484110 CGGAGAAGAAAGGGGAATGGAGG + Intergenic
1077745045 11:4893447-4893469 CTGAGAAGAAAGCAGTATAGTGG - Intronic
1078203285 11:9204074-9204096 CAGAGACCAGAGCAGCATGGAGG - Exonic
1078259221 11:9689082-9689104 CTGAAAAAAAAGCGGAGTGGGGG - Intronic
1078526773 11:12107436-12107458 GAGAGAAAAAAGAAGAAGGAAGG - Intronic
1078742529 11:14080529-14080551 CAGATAAGAAAGCACAATGCTGG - Intronic
1079119950 11:17674913-17674935 CAGAGAAAGAAGAAGCCTGGAGG + Intergenic
1079338347 11:19590741-19590763 TAAAGAAAAAACCATAATGGTGG - Intronic
1079378840 11:19918903-19918925 CAGAGCATAAAGCAGAAGGAAGG - Intronic
1079950968 11:26803924-26803946 GTGAGAAAAAAGGAGCATGGTGG - Intergenic
1080263212 11:30373357-30373379 GAGAGAAAAAAGAACAATTGTGG - Intergenic
1080567215 11:33521749-33521771 GAGAGAAAGAACCAGAATGCTGG - Intergenic
1080956441 11:37102009-37102031 CTGAGAAGAAGGGAGAATGGAGG - Intergenic
1080994491 11:37582498-37582520 CAGAGAAGAAGGAGGAATGGAGG + Intergenic
1081001020 11:37671702-37671724 GAGAGAGAGAAGCAGAATGTGGG + Intergenic
1081415126 11:42805593-42805615 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1082060350 11:47854836-47854858 TAAAAAAAAAAGCAGAATTGTGG + Intergenic
1082202557 11:49390455-49390477 CAGAGAAAAACTCAGAATCAAGG - Intergenic
1082811153 11:57479809-57479831 CAGACGAAAATGCAGAATGGGGG - Intergenic
1082828103 11:57596010-57596032 CAGAGAATAAAGCACAAAGCTGG + Intergenic
1083021414 11:59511213-59511235 CAGAGAAAAAATGAGAAAGAGGG + Intergenic
1083471106 11:62884606-62884628 GAAAGAAAAAAGCAGAATCAAGG - Intronic
1084574383 11:69979312-69979334 CAGAGAGATAAGCAGAAGGTTGG + Intergenic
1084939752 11:72606243-72606265 CGGAGAAAACAGCAGAGTTGTGG - Intronic
1085096346 11:73763367-73763389 CAGAGACCAAAGCAGCAGGGAGG - Intergenic
1085252609 11:75153494-75153516 CAAAGTAAACAGCAGAGTGGAGG + Intronic
1085270149 11:75265373-75265395 CAGAGAGAAAAGCAGAGGGAGGG - Exonic
1085362247 11:75900370-75900392 GAGAGAAAAAAAGAGAATGAGGG - Intronic
1085665104 11:78407945-78407967 CAGTGAAAATATCAGAATGAAGG + Intronic
1085715135 11:78865750-78865772 CAAAGAAAAAAGCAAAGTGTCGG - Intronic
1086188425 11:84048887-84048909 CAGGGAAAAAAGAAGAATTTTGG + Intronic
1086196444 11:84145774-84145796 CAGAGAAAAATGGAGAAGGCTGG + Intronic
1086473589 11:87145134-87145156 CATAGCAGAAAGTAGAATGGTGG - Intronic
1086494931 11:87393008-87393030 GGGAGAAAAAAACAGGATGGAGG - Intergenic
1086652475 11:89309633-89309655 CAGAGAAAAACTCAGAATCAAGG + Intergenic
1086670064 11:89535558-89535580 GAAAGCAAAAAGCAGAAAGGAGG - Intergenic
1086761710 11:90639384-90639406 AAGAGAAAAAAGGAGAGTGGGGG + Intergenic
1086920743 11:92583574-92583596 CAAAGAGAACAGCAGAATAGGGG - Intronic
1086992673 11:93322254-93322276 CAAAAAAAAAGGCATAATGGTGG + Intergenic
1087088423 11:94243430-94243452 CACAAAAAAAATCAGATTGGAGG + Intergenic
1087173438 11:95074310-95074332 CAGAGAAGAAAGGAGACTTGAGG + Intergenic
1087864507 11:103207445-103207467 CAGGAAAGAAAGCAGAATAGAGG + Intronic
1087922950 11:103887764-103887786 GAGAGATAAAAACAGATTGGAGG - Intergenic
1088138338 11:106584682-106584704 CAAACAGAAAAACAGAATGGGGG - Intergenic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088766433 11:112984464-112984486 CACAGTAGAAAACAGAATGGGGG - Intronic
1089124726 11:116168735-116168757 AAGAGACAAAAGCAGAGTGGGGG - Intergenic
1089409935 11:118232330-118232352 TGGAGAAAAAAGCAGAAAAGGGG - Intronic
1089773299 11:120818472-120818494 AACTGAAAAATGCAGAATGGGGG - Intronic
1089832400 11:121340131-121340153 CAGAGCAAAAAAGAGAAGGGAGG + Intergenic
1090032386 11:123218179-123218201 CAAAGAAGCAGGCAGAATGGAGG - Intergenic
1090132475 11:124159151-124159173 CATGTAAAAAAGCAGGATGGCGG - Intergenic
1091010024 11:131992550-131992572 ATGAGAAAACAGCAGAATTGAGG - Intronic
1091638663 12:2217214-2217236 TAGAGACAGAAGTAGAATGGTGG + Intronic
1091864919 12:3824621-3824643 GAGAGAACTAAGCAGAATGGAGG - Intronic
1091976035 12:4826379-4826401 CAGAGGCAAAAGCAGAAAGGAGG + Intronic
1092116215 12:6009937-6009959 AGAAGCAAAAAGCAGAATGGTGG + Intronic
1092156225 12:6283390-6283412 CAGAGACAGAAGTAGAATGGCGG + Intergenic
1092314814 12:7399423-7399445 AAGAGGAAGAAGAAGAATGGGGG - Intronic
1092629889 12:10365770-10365792 CAAAGAAGAAAGCTGATTGGAGG + Intergenic
1093038806 12:14356506-14356528 GAGAGAAAAAAAAAGAAAGGAGG - Intergenic
1093135764 12:15448596-15448618 CATAGGGAAAAACAGAATGGAGG + Intronic
1093692275 12:22121871-22121893 CAGAGAAAGAAGGAAGATGGGGG - Intronic
1094670020 12:32561035-32561057 CAGAAAATAAAGCAGAAATGTGG + Intronic
1094697470 12:32834686-32834708 AAGAGAAGAAAGAAGACTGGGGG + Intronic
1094790427 12:33906930-33906952 CAAAGAGAAAAGAACAATGGGGG + Intergenic
1095097113 12:38154757-38154779 CAGGGAAAAAAGCGGAAGGCCGG + Intergenic
1095566830 12:43634068-43634090 CTGATAAAGAAGCAGAGTGGAGG - Intergenic
1096296943 12:50392107-50392129 CAGTGACAGAAGCAGATTGGTGG + Intronic
1096335511 12:50752303-50752325 CGGAGAAAAAGCCAGAATAGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096655939 12:53092137-53092159 CAGAGATAAAAAAGGAATGGGGG + Intergenic
1096835803 12:54350450-54350472 CAGAGATAAGAGCAGCATTGAGG - Intronic
1097217753 12:57427713-57427735 CAGAAAATAAAGCAGAAAAGGGG + Intronic
1097437453 12:59568898-59568920 CAGAGAAAATAGAAGAGTCGAGG - Intergenic
1097625468 12:61994804-61994826 CAGAGAAAGAACCAGAAAAGAGG - Intronic
1098590673 12:72207913-72207935 CAGAGACAAAAGCAGATTAATGG - Intronic
1098769006 12:74528690-74528712 CAGAAAAAAAAGAAGAATGATGG - Intergenic
1098808144 12:75048216-75048238 CAGAGACAAAAACAGAAGAGGGG - Exonic
1099410835 12:82324496-82324518 AAGAAAAAAAAGCAGAATAAGGG + Intronic
1099480405 12:83158632-83158654 CAGAGAAGAGACCAGAATGGCGG - Intergenic
1100400909 12:94228595-94228617 GAGACAAAAAATTAGAATGGCGG - Intronic
1100514156 12:95310191-95310213 CATAGAGAAAAGTAGAATGATGG - Intergenic
1100806640 12:98292466-98292488 AAGAGAGAAAAGAAGAATGGAGG + Intergenic
1100939698 12:99712689-99712711 CAGATCAAAAAGTACAATGGTGG + Intronic
1101469786 12:104985878-104985900 CAAAGAAGAAAGTAGAATGGTGG + Intergenic
1102704426 12:114868977-114868999 GACAGAAAAAAGCAAAATGCTGG - Intergenic
1103252061 12:119508536-119508558 AAGAGAACAAAACAGAATGCTGG + Intronic
1103324070 12:120108772-120108794 CAGACGACAAAGCAGAATGAAGG + Intronic
1104200840 12:126587214-126587236 TAGAGACAGAAGTAGAATGGTGG + Intergenic
1104853400 12:131889969-131889991 CAGAGACAAAAGCAGAAGAGAGG + Intergenic
1104962447 12:132494618-132494640 CAGACACCAAACCAGAATGGTGG - Intronic
1105255423 13:18741274-18741296 CAGAGGGAAAAGCAGAATTAAGG + Intergenic
1105350180 13:19607886-19607908 CAAAAACAAAGGCAGAATGGAGG - Intergenic
1105361373 13:19720376-19720398 AACAGAAAAAAGCAGAAAAGAGG + Intronic
1105405969 13:20132934-20132956 TAGAACAGAAAGCAGAATGGTGG - Intergenic
1105989428 13:25603522-25603544 CAGAGACTAAAGCTGAAGGGAGG + Intronic
1106451920 13:29889842-29889864 CAAAAAAAAAAACAGAATAGGGG + Intergenic
1106509002 13:30396949-30396971 TAGAGACAACAGCAGAATGGTGG - Intergenic
1106903248 13:34377360-34377382 CAAAGGAAGAAGCAGATTGGTGG + Intergenic
1106945690 13:34824983-34825005 GAGAGTAGAAAGGAGAATGGTGG - Intergenic
1106947956 13:34849565-34849587 TGGAGAATAAAGCATAATGGAGG - Intergenic
1107132040 13:36907197-36907219 TAGAGAAGAAAGTAGAATGAAGG + Intronic
1107156533 13:37173663-37173685 CAGAAAAAAAAAAAAAATGGTGG - Intergenic
1107466924 13:40659405-40659427 CAGAACAAAAACCAGAATTGGGG + Intronic
1107819639 13:44274621-44274643 TAGAGAAAAGAACAAAATGGAGG + Intergenic
1108036595 13:46296640-46296662 GAGAGAAAGAATCAGAAAGGCGG - Intergenic
1108230571 13:48335913-48335935 CTGAGGAAAAAAGAGAATGGTGG + Intronic
1108408976 13:50129259-50129281 CAGAGAAAAAAAAAAAAAGGTGG - Intronic
1108807648 13:54179562-54179584 AAGAGAAAACTGCTGAATGGGGG - Intergenic
1108950245 13:56083614-56083636 CCGAGAAAATAGCAGAAGGAGGG + Intergenic
1109138157 13:58679641-58679663 AACAGCAAAAAGTAGAATGGTGG - Intergenic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109765209 13:66886355-66886377 CAGAGTTAAAATCAGAAAGGGGG + Intronic
1109892959 13:68642049-68642071 AAAAGAAAAAAGCAGAATTAAGG + Intergenic
1110473929 13:75891190-75891212 AAGAGATAACAGCAAAATGGTGG - Intergenic
1110554660 13:76844947-76844969 AAAAGCAAGAAGCAGAATGGTGG + Intergenic
1110904442 13:80867863-80867885 GAGAAAATAAAGGAGAATGGAGG + Intergenic
1110993401 13:82072484-82072506 CACAGTAAGAGGCAGAATGGTGG + Intergenic
1111137968 13:84075424-84075446 TAGAGTAATTAGCAGAATGGTGG - Intergenic
1111354733 13:87083485-87083507 CAGAGAAAAAATTAGAAGGCAGG - Intergenic
1111477044 13:88762978-88763000 TAGAGAAGAAAGCCTAATGGTGG + Intergenic
1112229704 13:97576360-97576382 CAGAAAAAAATACAAAATGGTGG - Intergenic
1112366879 13:98762833-98762855 CAAAGAAGGAAGCAGAATGGAGG + Intergenic
1112393786 13:99009688-99009710 CAGACACACAAGCAGGATGGGGG + Intronic
1112526066 13:100148422-100148444 CAGAGGAAAAAGTAGAGTAGGGG - Intronic
1112616225 13:101008506-101008528 CATGTAAAAAAGCAGAATGTTGG + Intergenic
1113362927 13:109648027-109648049 GAGAGAAAAAAACAGAAAGAAGG + Intergenic
1113451170 13:110410975-110410997 AGGAGAAAAGGGCAGAATGGTGG - Intronic
1114241289 14:20870805-20870827 AAGAGAGAAAAGAAGAAAGGAGG + Intergenic
1114324275 14:21573299-21573321 AAAAGAAAAAAAGAGAATGGTGG + Intergenic
1114397988 14:22384134-22384156 CAGAGGATAAAGCACAGTGGTGG + Intergenic
1114660867 14:24343384-24343406 TAGAGATGAAAGTAGAATGGTGG + Intergenic
1114682731 14:24499958-24499980 CATAGAAATAAGTAGAATGGTGG - Intergenic
1115131532 14:30057762-30057784 CTGAGAAAACAGAAGAAAGGGGG + Intronic
1115790968 14:36877732-36877754 CACAGAAAAAAGAAGAAAAGAGG + Intronic
1116133289 14:40889145-40889167 CACAGAAAAAAGAAGAAGGAAGG + Intergenic
1116375762 14:44198349-44198371 CAGAGAAACAAGGACAATGAAGG + Intergenic
1116824105 14:49655058-49655080 CACAGAATAAAGCAGGTTGGAGG + Exonic
1117481375 14:56148666-56148688 CAGAGAACACAGAAGAAAGGAGG - Intronic
1117547083 14:56802294-56802316 CAGCAACAACAGCAGAATGGAGG - Exonic
1117556852 14:56894891-56894913 CAGTTAGAAAAGCAGAATGGAGG - Intergenic
1117619009 14:57564927-57564949 GGGGGAAAAAAGCAGATTGGTGG - Intronic
1117644490 14:57837321-57837343 CAGCGAAAAGAGCAGAAGGGAGG + Intronic
1117763934 14:59060607-59060629 CAGAGCAGAGTGCAGAATGGTGG + Intergenic
1118715058 14:68553688-68553710 CAGAGACAAAAGCAGAGGTGGGG + Intronic
1119130330 14:72166802-72166824 CAGAGAAGAAAATAGAATGGTGG - Intronic
1119586759 14:75842960-75842982 CATAGCAAAAAGAAGAAAGGTGG + Intronic
1120187788 14:81412545-81412567 CAGAATAGAAAGTAGAATGGTGG + Intronic
1120193241 14:81458659-81458681 CTGAGAGCAAAGCGGAATGGAGG + Intergenic
1120428882 14:84388439-84388461 CAAAGAAAAGAGTAGAATGGCGG + Intergenic
1121092329 14:91191257-91191279 CAGGGCAGAAAGTAGAATGGTGG + Intronic
1122048074 14:99037506-99037528 CACAGAGAAAAGCAGAAGTGTGG + Intergenic
1122048303 14:99038797-99038819 CACAGAGAAAAGCAGAAGTGTGG + Intergenic
1122149906 14:99719592-99719614 CAGAGACAGAAGTGGAATGGTGG - Intronic
1122280702 14:100620635-100620657 CAGAGAATGCAGCAGAGTGGTGG + Intergenic
1123176513 14:106424036-106424058 CAGAGAATAAAACACAATGACGG - Intergenic
1202893134 14_KI270722v1_random:178430-178452 CAAAGAAAGAAGCAAATTGGAGG + Intergenic
1123485753 15:20736685-20736707 CAGAGAAAAAAACAGATCAGTGG + Intergenic
1123681098 15:22764668-22764690 CTGAGACAAAAGTAGAATGGTGG - Intergenic
1123792558 15:23736823-23736845 GAGAGAAAAAAGCAGTCTAGAGG + Intergenic
1124333315 15:28839129-28839151 CTGAGACAAAAGTAGAATGGTGG - Intergenic
1124390582 15:29252891-29252913 CAAAGAAAACAGCATAATGAAGG + Intronic
1124465558 15:29936180-29936202 CAGAGGGAAAGGGAGAATGGAGG - Intronic
1124642734 15:31406525-31406547 CAGAAAAAAAGAAAGAATGGAGG + Intronic
1124797048 15:32791989-32792011 CAGAGAATAGAGCAGAAAAGAGG + Intronic
1125341614 15:38681191-38681213 CAAAAAAAAAATCAGAATGAAGG - Intergenic
1125455024 15:39848939-39848961 AAGAAAAAAAAGCAGAAGAGAGG + Intronic
1126019245 15:44384259-44384281 GAGAGAAAAAAGCAAATTAGCGG - Intronic
1126558834 15:50021262-50021284 GAGAGACAAGAGCAGAATGACGG - Intronic
1126812719 15:52424021-52424043 CAGAGAAAAAATCACATGGGTGG - Intronic
1127176880 15:56367990-56368012 CAGAGAAAAAGAGAGAATGTAGG - Intronic
1127627258 15:60791835-60791857 CAGAGAAACAAACAGAATCTAGG + Intronic
1127821636 15:62662765-62662787 AAGATAAAAAGGCAGAAAGGGGG + Intronic
1128341257 15:66824014-66824036 AAGAGAGAGAAGGAGAATGGAGG + Intergenic
1129599562 15:76990491-76990513 AAGAGAATGAGGCAGAATGGAGG + Intergenic
1130209532 15:81910503-81910525 CCGAGAAGAGAGCAGAAGGGAGG + Intergenic
1130435809 15:83898296-83898318 AAGAAAAAGAAGAAGAATGGCGG + Intronic
1130662832 15:85844051-85844073 CAGAGAAGACAGCATAAGGGAGG + Intergenic
1130827944 15:87568652-87568674 CAGTGAAAAAAGGAAAATGCAGG + Intergenic
1131720299 15:95161123-95161145 CAGAGAAGAAAGTGGAATGCAGG + Intergenic
1131811708 15:96180132-96180154 CAGTGAGAAATGGAGAATGGAGG - Intergenic
1132020647 15:98359043-98359065 CACAGGAAGAAGCAAAATGGCGG + Intergenic
1132327986 15:100987890-100987912 CAGAGAAAATACCACAATGCTGG + Intronic
1132343195 15:101090963-101090985 AAGTGAAAAGAGCAGAATGTTGG - Intergenic
1202950556 15_KI270727v1_random:32869-32891 CAGAGAAAAAAACAGATCAGTGG + Intergenic
1132839322 16:1971207-1971229 AAGAAAAAAAAACAGAAGGGAGG - Intergenic
1133290352 16:4716567-4716589 CAGAGTCAAAAGTAGGATGGGGG - Intronic
1133443023 16:5836508-5836530 CAGAGAATAAGGAAGTATGGAGG - Intergenic
1133586774 16:7203341-7203363 CAGAGAGTCAAGGAGAATGGTGG + Intronic
1133598490 16:7316420-7316442 CAGAGAAATAATCAGATTTGAGG - Intronic
1134017323 16:10898106-10898128 CCGAGAAAAAAGGTGTATGGTGG - Intronic
1134106567 16:11489597-11489619 CACAGAATAGAGCAGAATGTGGG + Intronic
1134569381 16:15278459-15278481 CAGAGAGAAGAGGAAAATGGAGG - Intergenic
1134834300 16:17348114-17348136 CAGAGAAGAAAGGAGAGGGGTGG + Intronic
1134934442 16:18234387-18234409 CAGAGAGAAGAGGAAAATGGAGG - Intergenic
1135249062 16:20884966-20884988 AAAAAAAAAAAGCAAAATGGTGG - Intronic
1135327739 16:21538002-21538024 GAGAGATGGAAGCAGAATGGTGG - Intergenic
1135328147 16:21540774-21540796 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1135770583 16:25215147-25215169 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1135799519 16:25479530-25479552 CAGAGAGAAAAAGAGAGTGGGGG + Intergenic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1136338091 16:29624022-29624044 GAGAGATGGAAGCAGAATGGTGG - Intergenic
1136338500 16:29626794-29626816 CAGAGACAGAAGCAGCACGGCGG - Intergenic
1136591553 16:31220868-31220890 GAGAGAGAAAAAGAGAATGGTGG - Intronic
1137390113 16:48074341-48074363 CACAGAAGAAAGCAGAACAGGGG - Intergenic
1137442862 16:48511081-48511103 CAGGAAACAAAGCAGGATGGTGG - Intergenic
1137483596 16:48873153-48873175 CAGAGAAAACATCAGAAAGGAGG + Intergenic
1139041198 16:63001150-63001172 GAGAGAAAAGAGCACAATAGGGG - Intergenic
1140363597 16:74364882-74364904 CAGAGAACAAAGAAGATGGGGGG + Intergenic
1140399177 16:74656476-74656498 AAAAGAAAAAAAAAGAATGGTGG - Intronic
1140754381 16:78054468-78054490 AAGGGAAAAAAGCAGCATTGTGG - Intronic
1140892513 16:79297302-79297324 CAGAGAAAATAGCAAAACGGCGG + Intergenic
1140919402 16:79522980-79523002 CAGGGAGAAAGGCAGAATGACGG + Intergenic
1141004921 16:80343223-80343245 CTGAGAAGAAAGGAGACTGGAGG + Intergenic
1141409146 16:83820746-83820768 GAGAGAGAAAAGAAGAAGGGAGG - Intergenic
1141710718 16:85697444-85697466 CAGACAAAAAATAAGAATAGGGG + Intronic
1142041237 16:87895708-87895730 CAGAGACAGAAGCAGCAGGGCGG - Intronic
1142468945 17:151894-151916 TAGAGAAAACAGCAGAACAGAGG - Intronic
1144073868 17:11699903-11699925 GAGAGAGAAAAGCAGAAGGAGGG - Intronic
1144214684 17:13044825-13044847 CTGAGAAAAAAGGAGAAGAGAGG + Intergenic
1145772966 17:27506693-27506715 CACAGAAAAATGCAGCTTGGGGG - Intronic
1146423956 17:32718270-32718292 CAGACTAGAAAGCAGAATGGGGG - Intronic
1146606811 17:34266873-34266895 CACATAACAAAACAGAATGGTGG + Intergenic
1146635277 17:34499502-34499524 CAGGGAAAGGAGCAGAATTGGGG + Intergenic
1146668856 17:34723104-34723126 CAGAAAAAAATGCAGACTTGGGG - Intergenic
1146684863 17:34834892-34834914 CATTGAAAAAAGGGGAATGGGGG - Intergenic
1146961263 17:36982031-36982053 CAGAGAGAAAAGCAGAATGGTGG - Intronic
1147050948 17:37794469-37794491 CAAGGAAAAAAGCAGCCTGGAGG + Intergenic
1148170105 17:45512197-45512219 CACAGACAAAAGCAGAAATGTGG + Intergenic
1148170581 17:45516190-45516212 CACAGACAAAAGCAGAAATGTGG + Intergenic
1148250938 17:46079588-46079610 CAGATAAAAAGGAAGAATGCAGG - Intronic
1148279100 17:46333619-46333641 CACAGACAAAAGCAGAAATGTGG - Intronic
1148301318 17:46551472-46551494 CACAGACAAAAGCAGAAATGTGG - Intronic
1148866529 17:50631619-50631641 GAGAGAAGAAAGCAGAATGGGGG - Intergenic
1148971031 17:51481846-51481868 CAGCCAAAAAAGCAGAAAAGGGG - Intergenic
1149073598 17:52573585-52573607 CAGACACAAAACCACAATGGGGG - Intergenic
1149207913 17:54269705-54269727 GAGAGAAAAAATGAGAATGTTGG - Intergenic
1149365303 17:55937953-55937975 CACAAAAGAAATCAGAATGGTGG + Intergenic
1149750631 17:59142172-59142194 CAAAGAAAATAGAAGAATTGTGG - Intronic
1150138578 17:62709987-62710009 CAGAGCAAAAAGCAGCAGGAGGG - Intronic
1150401190 17:64857793-64857815 CACAGACAAAAGCAGAAATGCGG + Intronic
1150539153 17:66078204-66078226 CACAGAATAGAGCAGAATAGAGG - Intronic
1150638897 17:66936220-66936242 TAGAGACAAAAGTAGAATGGTGG - Intergenic
1150888979 17:69122714-69122736 AAGAGAAAGAGGCAGAAAGGGGG + Intronic
1150922221 17:69495653-69495675 CAAAAAAAAAGGCAGAGTGGGGG - Intronic
1151593819 17:75064584-75064606 CAGAGAAACAAGGAGACTGAGGG - Exonic
1151993522 17:77593888-77593910 CAGACCAAAGACCAGAATGGAGG - Intergenic
1152851170 17:82637006-82637028 CAGAGAACAAAGGAGACCGGGGG - Intronic
1203171336 17_GL000205v2_random:149785-149807 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1153630395 18:7063813-7063835 CATAGACAAAAGCTGAATGGAGG + Intronic
1154190654 18:12228586-12228608 CAGAGAAAAATGCAGAGGGTTGG + Intergenic
1155126611 18:22883634-22883656 GTGAGAAGAAAGCAGAATGTTGG + Intronic
1155168424 18:23249305-23249327 CAGATAATAGAGTAGAATGGAGG + Intronic
1155256541 18:24002720-24002742 TGTAGAAAAAAGCAGAATCGTGG + Intronic
1156884708 18:42121653-42121675 CAGGGTAAAAAGTAGATTGGAGG - Intergenic
1157363739 18:47044286-47044308 CAGACAAAAAAGTAGAGAGGTGG + Intronic
1157561291 18:48648248-48648270 CAAAGAAAAAGGGAGCATGGGGG + Intronic
1157864527 18:51169280-51169302 GAGAGAAAAATCAAGAATGGGGG - Intergenic
1158435395 18:57431855-57431877 CACACAAAAAAACATAATGGTGG - Intergenic
1159150919 18:64522790-64522812 CACAGAGAGAAGCAGAATGCAGG + Intergenic
1159560791 18:69991360-69991382 TAGAAAAAAAAGCAGACTGCTGG + Intergenic
1160292441 18:77607048-77607070 CAGAGAAACAAACAGAATCGTGG + Intergenic
1160557815 18:79737494-79737516 CAGAGAACAAAGCCGATTAGTGG - Intronic
1162082247 19:8225171-8225193 TAGAGAAAACAGCAGAGAGGAGG + Intronic
1162450439 19:10751104-10751126 CAGAGAAAAATGAGGCATGGGGG + Intronic
1163033554 19:14559361-14559383 CAGACAGAAAAGCAAATTGGAGG - Intronic
1164550890 19:29211786-29211808 CAGAGTAAAAAGAAAAGTGGCGG + Intronic
1165393736 19:35552757-35552779 TAGGGAAAATAGCAGAATAGGGG + Intronic
1166351636 19:42201627-42201649 CAGAGCAGAAAGGAGAATGCAGG + Intronic
1166921265 19:46230587-46230609 CAGGGAGACAAGGAGAATGGGGG - Intronic
1167024007 19:46901204-46901226 GTGAGAAAAAGGCAGAATGGTGG + Intergenic
1167961465 19:53107595-53107617 CAGAGAATAATGCAAAATGATGG - Intergenic
1168673466 19:58258856-58258878 CAGAGTGACAAGCAGAGTGGAGG + Intronic
925271503 2:2612700-2612722 CATAGAAGAGAGTAGAATGGTGG + Intergenic
925481796 2:4283718-4283740 CAGAGAAAGATGCAGTGTGGAGG - Intergenic
925973286 2:9122875-9122897 CAGAGAAAAAAGTAGATTCGTGG + Intergenic
926117172 2:10220911-10220933 TAGAGACAAAGGCAGAATGCTGG + Intergenic
926768440 2:16346025-16346047 GAGAGAAGAGAGCTGAATGGTGG + Intergenic
926968688 2:18444443-18444465 TAGAGGAAAAAGGAGAAAGGGGG + Intergenic
927337473 2:21941652-21941674 CAAACAGAGAAGCAGAATGGGGG - Intergenic
927432089 2:23035318-23035340 CAAAGAGAAAATCAGAGTGGGGG + Intergenic
927435825 2:23065251-23065273 CAAAAAAAAAACCAGAATGGGGG + Intergenic
927659595 2:24981626-24981648 TAGAGACAAAAGTAGAATGATGG - Intergenic
927806865 2:26155794-26155816 CAAAATCAAAAGCAGAATGGTGG + Intergenic
928017859 2:27675267-27675289 GAGACAGAAAAGTAGAATGGTGG - Intronic
928605561 2:32942483-32942505 CAGAAAGAAAAGCAGAAAGACGG - Intergenic
928773923 2:34736216-34736238 CAGATAAAAAGGCATAATGAGGG - Intergenic
928887448 2:36165960-36165982 TAGAGACACAAGTAGAATGGGGG + Intergenic
928934179 2:36657452-36657474 GAAAGGAAAAAGCAGAATGGTGG + Intergenic
928949115 2:36798957-36798979 CACAGCAATCAGCAGAATGGGGG - Intronic
929738044 2:44572173-44572195 CAGAGACAAAAGTAGAATGGTGG - Intronic
929843374 2:45495498-45495520 GAAAGAGAAAAGCAGAATGCGGG - Intronic
930596581 2:53397030-53397052 CAGTGGAAAAAACATAATGGTGG + Intergenic
930654710 2:53996344-53996366 GAGATAAAAAAGGAGGATGGAGG + Intronic
930882803 2:56291453-56291475 CAGAGAAAATAGCAGTGTGGGGG + Intronic
931409472 2:62015208-62015230 CAGAGAAAAAAGTAGAAAAGAGG - Intronic
931705392 2:64942659-64942681 AAGAGAATAAAGCAGCATGAGGG + Intergenic
931862965 2:66376342-66376364 CAGAAAAAATAGCAGTATGGAGG - Intergenic
932289779 2:70567048-70567070 CAGAGAAACAAGAACAATAGGGG - Intergenic
932297163 2:70635589-70635611 CATAGAAGAGAGTAGAATGGTGG + Intronic
932375998 2:71236284-71236306 CTAAGAAAAGAGAAGAATGGCGG + Intergenic
932502701 2:72197979-72198001 CAGAGCAAAGAGGAGAATGTTGG + Intronic
932751039 2:74371864-74371886 CAGTGAGAAAAGAAGAATGAAGG + Intronic
933000510 2:76916603-76916625 CAGTTAGAAAAGAAGAATGGAGG + Intronic
933074442 2:77905656-77905678 TAGAGAAAAAAGCACAAAGATGG + Intergenic
933086188 2:78057470-78057492 CATAGAAAAAAGAACCATGGAGG - Intergenic
933279710 2:80319663-80319685 CAGAGTGAAAAGCAGAATTGTGG - Intronic
933858068 2:86437012-86437034 AAGAGAAAAAAGTAGAAGAGAGG + Intergenic
934576570 2:95405527-95405549 CAGAGAAAAATGCAGGATCCAGG - Intronic
934638794 2:96013698-96013720 CAGAGAAAAATGCAGGATCCAGG - Intergenic
935211987 2:100946220-100946242 CTGAGGAAAATGCAGCATGGAGG + Intronic
935309394 2:101768536-101768558 CAGAAAAAAAAGTAGACTGTGGG - Intronic
936407123 2:112214725-112214747 CAGAGGAAAGGGGAGAATGGAGG + Exonic
936614366 2:114033495-114033517 CACAGAAAGAGGCAGATTGGGGG + Intergenic
937408431 2:121651353-121651375 CAGAGACAGAACTAGAATGGAGG - Intergenic
937763821 2:125636006-125636028 CAGAGAAGAAAGCAGATGAGTGG - Intergenic
937792638 2:125978736-125978758 CAAAGAGAAAAGGAGAAAGGAGG + Intergenic
938421251 2:131148657-131148679 CAGAGAGAAAAGCAGACCCGTGG - Intronic
938451214 2:131423063-131423085 CAGAGAAATATGCAGAAGGCAGG - Intergenic
939164387 2:138624645-138624667 CAAAGAAACAAGCAGAATTTAGG - Intergenic
939546301 2:143558374-143558396 CAGAGAAGAAATCTGACTGGAGG - Intronic
939976714 2:148725989-148726011 AAAAACAAAAAGCAGAATGGTGG - Intronic
940988414 2:160072923-160072945 CAGAGTACAGAGCAGAGTGGAGG + Intergenic
941523259 2:166575541-166575563 GAGAAAAAAAAGCAAATTGGAGG + Intergenic
941628384 2:167856261-167856283 AAGAGCAAAAAGCAGAAGGAAGG + Intergenic
941695155 2:168543374-168543396 CAGAGATAGAAGCAGATTGATGG - Intronic
941751320 2:169137813-169137835 CACAGAGAAAAGGATAATGGTGG + Intronic
941915119 2:170807086-170807108 CAAAGCAAAAAGTAGAATGGTGG - Intergenic
942133449 2:172902983-172903005 AATAGAAAAAATCATAATGGAGG + Intronic
942391393 2:175497399-175497421 CTGAGAAAAAAGAAAATTGGAGG - Intergenic
942494663 2:176527121-176527143 CAGAGAAAAGAGGAAAAAGGAGG - Intergenic
942710008 2:178823168-178823190 CAGAGAAAAAATAATCATGGTGG - Intronic
942739065 2:179152888-179152910 CAAAGAAAATAGAAGAAAGGAGG + Intronic
943165603 2:184321257-184321279 GAGACAGAAAAGTAGAATGGTGG + Intergenic
943221737 2:185118292-185118314 CATACAAGAAAGAAGAATGGTGG + Intergenic
943407071 2:187502481-187502503 TTGAGAAAAAAGCCGAATGAGGG + Intronic
943544838 2:189262278-189262300 CAGAGAAAAAAACTGAAGGTAGG - Intergenic
944658361 2:201899235-201899257 CAGGTAAGAAAGCAGAATGAGGG + Intergenic
945093809 2:206200426-206200448 CAAAGAAAGAAAAAGAATGGTGG + Intronic
945225817 2:207530296-207530318 CAGCGAACAAAGAATAATGGCGG + Intronic
945287021 2:208093017-208093039 CATAGAGGAAAGCAGAGTGGAGG + Intergenic
945339561 2:208635822-208635844 GAGATTAAAAAGTAGAATGGTGG + Intronic
945526222 2:210890598-210890620 CAGAAAATAAAAAAGAATGGAGG + Intergenic
946053380 2:216881798-216881820 AAGAGAAGAAAGCAGACAGGAGG + Intergenic
946588287 2:221215307-221215329 CAGAGAAAAATGCTGAATGCAGG + Intergenic
946931181 2:224673061-224673083 CATAGAAAAAAGTAAAGTGGTGG + Intergenic
947269399 2:228317203-228317225 CACAGTAAAAAGAGGAATGGAGG - Intergenic
947374285 2:229480064-229480086 CAGAAAAAATAGAAGAATGCAGG + Intronic
947375371 2:229489895-229489917 CAGAGAGAAAAGCAGCATGAGGG + Intronic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947648449 2:231763339-231763361 CAAGGAAAAAAGGAGAATAGAGG - Intronic
947678027 2:232002614-232002636 CATAAAACAAACCAGAATGGGGG - Intronic
947698738 2:232215243-232215265 CAGAGAGGAAAGCAGCAAGGAGG - Intronic
947762891 2:232616642-232616664 GAGAGACAGAAGTAGAATGGTGG + Intronic
947871001 2:233437971-233437993 AAGAGAAGACAGCAGAAAGGTGG + Intronic
948184770 2:236012303-236012325 CATATAAATAGGCAGAATGGAGG - Intronic
948321974 2:237076970-237076992 CATAGAGAGAAGCAGATTGGTGG - Intergenic
1168995887 20:2132967-2132989 CAAACAAAATAGCAGGATGGGGG - Intronic
1169515136 20:6308645-6308667 TAGAGTAGAAAGTAGAATGGTGG - Intergenic
1169620824 20:7504711-7504733 CAGAACAAAAAGCAGATTGTTGG + Intergenic
1170047741 20:12103859-12103881 AAGAGAGGAAAGGAGAATGGAGG + Intergenic
1170868586 20:20183464-20183486 CAGCTCAAAAAGCAGAATGTAGG - Intronic
1171070580 20:22064480-22064502 CACAGAAATAAGCAGAAAGGTGG - Intergenic
1171293465 20:23995751-23995773 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1171724920 20:28607702-28607724 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1171753153 20:29075349-29075371 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1171858420 20:30372291-30372313 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1172452586 20:35038028-35038050 CAGAGAAAAAAGCAGAATGGTGG + Intronic
1172647994 20:36483549-36483571 CAGAGAAAAAAGGGGAAATGGGG + Intronic
1172782913 20:37447783-37447805 CAGAGGAAACAGGAGAAGGGTGG - Intergenic
1172787670 20:37479911-37479933 CAGAGAGGAAAGCAGCAGGGGGG - Intergenic
1172833506 20:37856864-37856886 CAGAAAAATAAGGAAAATGGAGG - Intronic
1173131233 20:40395616-40395638 GAGAGAAAACAGAAGATTGGAGG + Intergenic
1173523442 20:43715537-43715559 AAGAGAGAATGGCAGAATGGGGG - Intronic
1174132603 20:48356549-48356571 CAAGGAAAAAAGGAGAGTGGTGG - Intergenic
1174187530 20:48717223-48717245 AAGAGAAAAAGGCAGGAGGGTGG + Intronic
1175203711 20:57294991-57295013 AAGAGCAAAGAGCAGATTGGGGG + Intergenic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1176038619 20:63052527-63052549 CAGAGGAAGAGGCAGAAAGGAGG + Intergenic
1176155526 20:63618186-63618208 CAAAGGAAAAAGGAGAATGGAGG + Intronic
1176327320 21:5511613-5511635 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176330389 21:5544618-5544640 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176397368 21:6276333-6276355 CAGAGGAAAAAGGAGCACGGAGG - Intergenic
1176400437 21:6309338-6309360 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1176436720 21:6679766-6679788 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176439789 21:6712771-6712793 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176460982 21:7006836-7006858 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176464051 21:7039840-7039862 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1176484543 21:7388614-7388636 CAGAGGAAAAAGGAGCATGGAGG - Intergenic
1176487612 21:7421619-7421641 CAGAGGAAAAAGGAGCACGGAGG + Intergenic
1177097933 21:16861527-16861549 CAAATAAGAAAACAGAATGGAGG - Intergenic
1177732995 21:25053112-25053134 CAGAGAATAGAATAGAATGGTGG + Intergenic
1178130458 21:29566005-29566027 TAGATAAAAAAGTAGAATGTTGG + Intronic
1178313170 21:31546599-31546621 CTGAGAAAAATGGAGAAGGGTGG + Intronic
1178376539 21:32072246-32072268 CAGAAAAAAGGGGAGAATGGAGG - Intergenic
1178579775 21:33828622-33828644 CAGAAAAAAAAGAAGAAAGAGGG - Intronic
1179052437 21:37899425-37899447 GAGAGAAAGAAGCAGAGTGAGGG - Intronic
1180298470 22:10966394-10966416 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1180409942 22:12597412-12597434 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1180567633 22:16688431-16688453 AGAAGCAAAAAGCAGAATGGTGG + Intergenic
1180824521 22:18853467-18853489 CAAAGAAAACAGAAGCATGGAGG - Intronic
1181097746 22:20517508-20517530 CAGTGAAAAGAGCAGGGTGGTGG - Intronic
1181124943 22:20696622-20696644 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181188214 22:21121081-21121103 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181210982 22:21289412-21289434 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181398518 22:22637476-22637498 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181650897 22:24258584-24258606 CAAAGAAAACAGAAGCATGGAGG - Intergenic
1181706484 22:24652155-24652177 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1181785349 22:25222573-25222595 CACAGAAAAATGAAAAATGGGGG + Intronic
1181916328 22:26283574-26283596 CAGAGAAAAAAGCAGTTTTCAGG + Intronic
1182033165 22:27176067-27176089 AAGGGAAAAAAGCAGAAGGAAGG + Intergenic
1182191171 22:28462324-28462346 CAGAGAGAAAAGAAGCATGATGG - Intronic
1182640703 22:31764742-31764764 GAGAGAAAAAGGGAGAAGGGAGG - Intronic
1183175036 22:36217281-36217303 CAGAGAAACAGACAGAATTGAGG - Intergenic
1184105202 22:42363400-42363422 CAGGGAAAGAAGCTGAAAGGTGG + Intergenic
1184429949 22:44436783-44436805 TAGAGACAGAAGTAGAATGGTGG - Intergenic
1184474080 22:44711328-44711350 CAGAGGGAACAGCAGGATGGAGG + Intronic
1184917217 22:47578067-47578089 TTTAGAAAAAAGCAGAATAGAGG - Intergenic
1184958200 22:47906944-47906966 AATAGAAAATAGAAGAATGGGGG + Intergenic
1185201149 22:49506251-49506273 CAGTGGAAGAAGCAGCATGGTGG - Intronic
1203215964 22_KI270731v1_random:6018-6040 CAAAGAAAACAGAAGCATGGAGG + Intergenic
1203239170 22_KI270732v1_random:38858-38880 AAGAGAAAAGAGATGAATGGTGG + Intergenic
1203274659 22_KI270734v1_random:79372-79394 CAAAGAAAACAGAAGCATGGAGG - Intergenic
949437505 3:4045420-4045442 AAGAGAAACAAGCAGAAAGATGG - Intronic
949606595 3:5660358-5660380 CAGAGAATAAAGCAAGTTGGGGG + Intergenic
949725768 3:7042515-7042537 CAGAGAAAAAGAAAGAATGGGGG - Intronic
949996427 3:9620833-9620855 CAGAGAAAAAAGGAGACAGAAGG - Intergenic
950216653 3:11164576-11164598 CAGAGAAAAAGTAAGCATGGAGG - Intronic
950654449 3:14427974-14427996 CAGGGCAGAAAGCAGAGTGGAGG - Intronic
950676175 3:14555694-14555716 CAGAGAAGGAAGCAGAGCGGTGG + Intergenic
950698742 3:14725390-14725412 CAGAGAGACAGGCAGAATGGCGG + Intronic
950772567 3:15323936-15323958 AAGGGAAATAAGCAGTATGGGGG + Intronic
951568984 3:24042316-24042338 CAGTGAAGAAAGCAGACAGGAGG + Intergenic
952196308 3:31078886-31078908 CAGAGAAGAAAACAAAATGCTGG - Intergenic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
954363137 3:50133001-50133023 CAGAGAAGAAAGAAGAAACGAGG - Intergenic
955981963 3:64535955-64535977 CTGAGTGGAAAGCAGAATGGAGG - Intronic
956126572 3:66016637-66016659 AAGAAAGAAAAGCAGAATGGAGG + Intronic
956148111 3:66212669-66212691 TAGAGATAAAAGTAGCATGGTGG - Intronic
956175151 3:66465889-66465911 TAGAGACAGAAGTAGAATGGTGG - Intronic
956398876 3:68855000-68855022 CAGAGTAAAAATCATAATAGGGG + Intronic
956465541 3:69517293-69517315 CAGAGGAAAAAGTGGAATGAAGG - Intronic
956514028 3:70026368-70026390 CAGAGGAAAAAGTAGAAAGAAGG - Intergenic
957650636 3:82998089-82998111 AAGAAAAAAGAGTAGAATGGTGG + Intergenic
958992709 3:100865756-100865778 AAGAGAAAAAAGTATAATTGGGG + Intronic
959246171 3:103871760-103871782 CAGTATAAAAAGCAGTATGGAGG + Intergenic
959426005 3:106189420-106189442 CACATAAAAAATTAGAATGGTGG - Intergenic
959871161 3:111330019-111330041 CAGAGAAGAATGCAGCAGGGTGG + Intronic
961015236 3:123463241-123463263 TAGGGATAAAAGCAGATTGGTGG + Intergenic
961930156 3:130524482-130524504 CAGAAAAATAGGCAAAATGGTGG + Intergenic
961986896 3:131144392-131144414 CTGATACAAAAGCAGATTGGGGG - Intronic
962403811 3:135083293-135083315 CAGAGGAGAAAGCAGCAGGGGGG + Intronic
962514539 3:136138004-136138026 CAGGGAAACAGGGAGAATGGAGG + Intronic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963548716 3:146694664-146694686 CCAAGAAAGAAGCACAATGGTGG - Intergenic
963570587 3:146990068-146990090 CAGGTAACAAAGCAGAATAGAGG - Intergenic
963659362 3:148104558-148104580 CAGAGAAGGAAGCAGATAGGAGG + Intergenic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964463159 3:156959550-156959572 AAGAAAAAAAGGCAGAGTGGTGG - Intronic
964806817 3:160619262-160619284 CAGAGAAAAAATCAAACTGAGGG - Intergenic
964849642 3:161081330-161081352 CACAGAAGAAAGCGGGATGGTGG + Intergenic
964873020 3:161334171-161334193 AAGAGAAAAAGCCATAATGGAGG + Intergenic
965798287 3:172464754-172464776 CTGACAAAAAGGCACAATGGAGG + Intergenic
965886900 3:173457116-173457138 CAGAGAAAGACACAGAAGGGTGG + Intronic
965979223 3:174666863-174666885 TAGAAACAAAAGGAGAATGGTGG - Intronic
966311527 3:178599790-178599812 GAAAGAGAAAAGTAGAATGGTGG - Intronic
966352521 3:179046366-179046388 CAGGGAAAATAGCAGACAGGAGG + Intronic
966475496 3:180340213-180340235 GGGAGAAAAAATCAGAATGATGG - Intergenic
967224881 3:187281798-187281820 CAGAGGAAAAAACAGAATTTTGG + Intronic
967301925 3:188022609-188022631 CAGGGGAAAAGGCAGGATGGAGG - Intergenic
968034195 3:195531888-195531910 TAGAGATAGAAGTAGAATGGTGG - Intronic
969031066 4:4214756-4214778 CATAGACAGAAGTAGAATGGTGG + Intronic
969525310 4:7701233-7701255 GAGAGAAAAAAGGAGAGAGGAGG + Intronic
969748915 4:9095518-9095540 GGGAGAAGAAAGGAGAATGGAGG - Intergenic
969921470 4:10544501-10544523 CAGAAAATAAAGCAGATTGGAGG + Intronic
970398328 4:15694082-15694104 CAGAGAACAAAGGAGACTGGGGG + Intronic
970645046 4:18110049-18110071 CAGAAACAAAAGCAGAATTCGGG + Intergenic
971304138 4:25465611-25465633 CAGACAAAGAGGTAGAATGGTGG + Intergenic
971509467 4:27406185-27406207 CAGAGAAAAATGTAAAATTGTGG + Intergenic
971703049 4:30005712-30005734 GAGAAAAAAAAGAAGAATGTTGG - Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972640245 4:40918737-40918759 CAGAGAAAAAATAAGGAAGGAGG - Intronic
973259235 4:48144473-48144495 CAGAAGGAAAAGAAGAATGGAGG + Intronic
973636521 4:52866203-52866225 AAGAGAAAAAAGAAAAAAGGGGG - Exonic
974152665 4:58029406-58029428 AAGAAAGAAAAGCAGAATGATGG - Intergenic
974369976 4:61003459-61003481 CAAAGCAGAAAGTAGAATGGTGG + Intergenic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974645731 4:64688768-64688790 AAGATAAAAAAGCTGAATGTTGG - Intergenic
974861030 4:67521896-67521918 GACAGAAAAAAGTAGAATGGTGG + Intronic
974977516 4:68908348-68908370 AAGAAAAGAAAGTAGAATGGTGG - Intergenic
975162094 4:71135754-71135776 AAAAGCAAAAAGTAGAATGGTGG - Intergenic
975606385 4:76158546-76158568 AAGACAGAAAAGCAGAATGTGGG + Intergenic
976088660 4:81432117-81432139 AAGACAATAAAGCAGAATGATGG + Intronic
976212279 4:82683129-82683151 GAGAGAAAACAGGAGCATGGCGG + Intronic
976306137 4:83561129-83561151 TAGAGAAAACAGCACAATGGGGG + Intronic
976391437 4:84508850-84508872 AAAAAAAAAAAGCAGAATGCAGG + Intergenic
976398349 4:84582110-84582132 AAGAGAAAAAAGAAAAAAGGCGG - Intergenic
976421126 4:84845380-84845402 AGAAGAAGAAAGCAGAATGGTGG + Intronic
976554210 4:86432095-86432117 TAGAGAAGAAAGCCTAATGGTGG + Intronic
976944463 4:90747480-90747502 CAGAGAAAAAAAAAGAGAGGTGG + Intronic
977174183 4:93798951-93798973 CAGAGAAAAAAGCAGGGGGTAGG + Intergenic
977377858 4:96230301-96230323 CAGAGAAGGAAGAAAAATGGTGG + Intergenic
977545351 4:98370473-98370495 TGGAGAAAAAAGGAGAAAGGAGG - Intronic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977773754 4:100892886-100892908 AAGAGAAACAAGCAGACTGAAGG - Intergenic
977783216 4:101003814-101003836 CAAAGAAAAATGAAGAGTGGAGG - Intergenic
978712946 4:111807655-111807677 AAGAGAAAAAAGCAGGAGGTCGG + Intergenic
979092667 4:116505190-116505212 AAGAGAAAAAATCAGTATGGAGG + Intergenic
979549926 4:121979228-121979250 CAGAGAAAAAAGTAGAGGGAAGG + Intergenic
980124296 4:128758978-128759000 CAGAGAAAGAAATAGAATGGAGG + Intergenic
980664349 4:135909698-135909720 CAGAAAAAAATGCAAAAAGGAGG - Intergenic
980751397 4:137094684-137094706 AAAAGAATAAAGCAGAATGGTGG + Intergenic
981791974 4:148548374-148548396 CACAGAAGAAAGTAGAATGGTGG + Intergenic
981871743 4:149495130-149495152 CAGAGAAAGAAAAAGAATGAAGG + Intergenic
982125921 4:152183841-152183863 ACCAGACAAAAGCAGAATGGAGG - Intergenic
982220549 4:153121545-153121567 GAATGAAAACAGCAGAATGGAGG + Intergenic
982973081 4:162015750-162015772 TAAAGAAAAAAGTAGAAAGGAGG - Intronic
983021539 4:162682866-162682888 AAGAGATAAAAGCAGGATGCTGG - Intergenic
983568808 4:169182856-169182878 CAAAAAAAAAAGGAGAAAGGTGG + Intronic
983778244 4:171635648-171635670 CAGAGAGCTAAGCAGACTGGGGG + Intergenic
983907840 4:173203530-173203552 AAGAGAGAAGAGCAGAATGAAGG - Intronic
984218081 4:176939622-176939644 CAGAGAGAAGAGCAGTATGCTGG - Intergenic
984316086 4:178134286-178134308 CAGAGAAAATAACAGACTCGAGG + Intergenic
984405311 4:179321548-179321570 CAGAGAAAAAAGAAAAAGGAAGG - Intergenic
984455229 4:179957972-179957994 CACAGCCAAAAGCAGAAGGGAGG + Intergenic
984559057 4:181246937-181246959 CAGAGAGCAAAGGAGGATGGAGG + Intergenic
984665030 4:182417806-182417828 CAAAGAAAATAGCAAAATGATGG - Intronic
984724483 4:183007752-183007774 TAGACACAAAAGTAGAATGGGGG + Intergenic
985050310 4:185984176-185984198 CAGAGAAACAATAAGAATTGTGG - Intergenic
985092505 4:186378528-186378550 CAGAGAAAAGAACATCATGGTGG - Intergenic
985723395 5:1502416-1502438 CAGAGAAGACGGCAGAATGAAGG + Intronic
986392091 5:7296659-7296681 CTGAGACAAAAGTAGAATGGTGG - Intergenic
986542500 5:8861325-8861347 CAGAGAGAAAAGCTGAGAGGAGG + Intergenic
987038852 5:14043146-14043168 CAGTGAAAAAAGGAAAATGTTGG - Intergenic
987154096 5:15070507-15070529 CAGAGAAATAAGCAGAGTTTGGG + Intergenic
987865363 5:23528954-23528976 CAGAAGAAAAAGGAGAAAGGAGG + Intergenic
987910127 5:24132341-24132363 GAGAGAAGAAAGAAGAAAGGAGG + Intronic
987959366 5:24785408-24785430 CAGAGAATAATTCAGAATGCTGG - Intergenic
988229259 5:28452744-28452766 CAGAGAATAAAGGAAAATGAAGG + Intergenic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
988679657 5:33472445-33472467 CAGAGAAAAAAAATGACTGGTGG - Intergenic
988993230 5:36691255-36691277 CAGAGAAAAATTCAAAATGGGGG - Intergenic
989299765 5:39876976-39876998 CAGAGAAAAAAGAGGAAGGAGGG + Intergenic
989490442 5:42046832-42046854 AAGAGAAGAAAGGAGAAGGGAGG + Intergenic
989682828 5:44049073-44049095 CAGAGACAAAGGCAGAATTGAGG - Intergenic
990816407 5:59790685-59790707 AAGAGGAGGAAGCAGAATGGAGG - Intronic
991051714 5:62279806-62279828 CAGAGAAGGAAGCAGAATTAAGG + Intergenic
991203703 5:64024477-64024499 CAAGGAAGAAAGAAGAATGGAGG - Intergenic
992589333 5:78277383-78277405 CAGGAAAAAAAGGAGAAGGGAGG + Intronic
992741104 5:79774412-79774434 CTGAGGAAACAGCAGAACGGTGG - Intronic
993010500 5:82477293-82477315 CAGTGACAAGAGCAGAAAGGGGG - Intergenic
993965858 5:94359899-94359921 CAGACAAGAAAAGAGAATGGTGG - Intronic
994047044 5:95321818-95321840 AAGAGAAAAAAGCAGCTTGAAGG + Intergenic
994456542 5:100015638-100015660 AGAAGAAAAAAGCAGAATTGGGG - Intergenic
994521690 5:100846239-100846261 CAGGGAACCAAGCAGAATTGAGG - Intronic
995019972 5:107355031-107355053 CAGAGAAGAAAGTTGAATAGAGG + Intergenic
995366873 5:111371913-111371935 TAGAGAAAACAGCAGAATTGAGG + Intronic
995579663 5:113583408-113583430 CAGAGACAAATTCAGAATGTAGG - Intronic
995778976 5:115755710-115755732 CAGACAGAGAAGCACAATGGAGG + Intergenic
995900038 5:117054863-117054885 CAGAGCAAAATGCAAGATGGGGG - Intergenic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996547903 5:124700101-124700123 CAGAGAACAAAGAAAAATGAAGG - Intronic
996990479 5:129624331-129624353 CAGAGGTGAAAGCAGAGTGGAGG - Intronic
996994670 5:129680813-129680835 AAGAGAAAAAATCAGGATGATGG + Intronic
997637095 5:135419976-135419998 CACAGAGAAAAAAAGAATGGGGG - Intergenic
997769081 5:136536380-136536402 CAAAGAAAATAGTAGAAAGGAGG - Intergenic
997994446 5:138574723-138574745 CAGAAAAAAAAGCAGATCGTGGG - Intronic
998326381 5:141284231-141284253 CAGATAAAAAAGTAGAACTGTGG + Intergenic
999065705 5:148683463-148683485 CAGAGAGCAAAGGAGAGTGGTGG + Intergenic
999181643 5:149674060-149674082 AAAAAAAAAAAGTAGAATGGCGG + Intergenic
999525734 5:152404303-152404325 CAGAGAAAAACTTAGAATTGGGG - Intronic
999794569 5:154977009-154977031 CAGAGACAGAAGTAGAATGGTGG - Intergenic
1000674923 5:164108861-164108883 TAGAGAATGAAGCAGAATGAAGG + Intergenic
1000896497 5:166861605-166861627 GAGAGAAAAAAGCCAAAGGGTGG + Intergenic
1001519981 5:172384539-172384561 TAGAGACAGAAGTAGAATGGTGG - Intronic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1001852570 5:174982306-174982328 CAGAAAACAAAGCAGAAACGTGG + Intergenic
1002363274 5:178690472-178690494 CATAGAAGAGAGTAGAATGGTGG - Intergenic
1002518382 5:179775707-179775729 CAGAGAAAACTGCAGAAGGTGGG - Exonic
1002560183 5:180076229-180076251 AAGAAAAGAAATCAGAATGGTGG - Intergenic
1002885716 6:1292164-1292186 CAGAGTTAAGAGCAGAATAGGGG - Intergenic
1003031489 6:2605003-2605025 GAAAGATAGAAGCAGAATGGAGG + Intergenic
1003597900 6:7490837-7490859 CAGAAAAAAAAGGCGGATGGGGG - Intergenic
1003613975 6:7638322-7638344 CATGGAAACAAGAAGAATGGTGG + Intergenic
1003689037 6:8334077-8334099 CAGAGACAGAAGCAGATTGTTGG - Intergenic
1005060537 6:21773179-21773201 CATTGGAAAAAGCAGAAAGGAGG + Intergenic
1005370326 6:25125218-25125240 CAGAAAAAAAAGCAAAGTGGAGG + Intergenic
1005436845 6:25821228-25821250 GAGAGAAAAAAGAAGAATGGAGG - Intronic
1005534784 6:26744415-26744437 CAGAGAAAGAAGGAGAGTGGTGG + Intergenic
1005804665 6:29462974-29462996 CAGTAAAAAGAACAGAATGGAGG - Exonic
1005972671 6:30773593-30773615 AAAAAAAAAAATCAGAATGGTGG + Intergenic
1006102976 6:31697653-31697675 CAGAAAGGAAAGCAGAAAGGAGG - Intronic
1006241345 6:32682007-32682029 CAAAGAGAAAAGAAGAGTGGGGG + Intergenic
1006308801 6:33242595-33242617 AAGAGAAGAAAGAAGAAAGGAGG + Intergenic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1006951989 6:37830277-37830299 CACAGAGGAAAGTAGAATGGTGG + Intronic
1007071485 6:39041431-39041453 CAGAGAAAAAGGCAGACAAGTGG + Intergenic
1007287369 6:40757363-40757385 CAGAGAGAGAAGCAGGTTGGTGG + Intergenic
1007436646 6:41817610-41817632 AAAAGAAAAAAGAAAAATGGTGG - Intronic
1007906412 6:45465941-45465963 CATAGAAAAAAGAAGTAGGGCGG - Intronic
1008071135 6:47100304-47100326 CAGAGAACAAAGGAAGATGGAGG - Intergenic
1008265886 6:49425790-49425812 CAGAGAAAAAAGTAGAATGGTGG - Intergenic
1008560366 6:52718745-52718767 TTGAGTAGAAAGCAGAATGGAGG - Intergenic
1008670302 6:53761522-53761544 CAGAGAAAGAACCACAATGTTGG - Intergenic
1009901698 6:69815010-69815032 CAGAGTAGAAAGCCTAATGGTGG - Intergenic
1009950736 6:70392795-70392817 CAGAGATAAAATAAGAAAGGAGG + Intergenic
1010653408 6:78481367-78481389 CTGAGAGAGAAGCAGAAAGGAGG - Intergenic
1011248628 6:85346617-85346639 GAGACAAAAAAGTAGAATGATGG + Intergenic
1011261242 6:85471995-85472017 GAGAGAAAAAAAGAGAGTGGTGG - Intronic
1012311685 6:97733200-97733222 GAGAGAAAAAAGTAGAATGAAGG + Intergenic
1012781160 6:103559294-103559316 CAAAGAACAAAGGAGAAAGGAGG + Intergenic
1012931957 6:105326785-105326807 CAGAGAAAAGAGAAAAATGGAGG + Intronic
1012974305 6:105763557-105763579 AAGAGAAAAAAGGGTAATGGAGG - Intergenic
1013061619 6:106639516-106639538 CTGAGAGAAAAGGAGAATAGGGG - Intronic
1013093793 6:106925492-106925514 AAGAGAAAGAAAAAGAATGGAGG + Intergenic
1013169190 6:107620769-107620791 CACAGAAAAAAGAAATATGGTGG - Intronic
1013182434 6:107729358-107729380 CAGAGAAAACACCACAGTGGAGG - Intronic
1013236919 6:108205200-108205222 CAGAGAAAAAAGTAAAATAAGGG - Intergenic
1013570027 6:111413287-111413309 GGGGGAAAAAAGTAGAATGGAGG + Intronic
1013930639 6:115528181-115528203 CAGAGAACATAGCAGATTTGTGG - Intergenic
1014442674 6:121491559-121491581 AATAGGGAAAAGCAGAATGGTGG + Intergenic
1014670169 6:124293833-124293855 AATAGAAAAAAGCAGAAATGAGG - Intronic
1014785352 6:125612224-125612246 CAAACAAAAAAGGAAAATGGGGG - Intergenic
1014981551 6:127951760-127951782 CAGAGAGAAAAACAGAGTGGTGG + Intergenic
1014992056 6:128093047-128093069 CAAATAAAAAACCATAATGGTGG + Intronic
1015158699 6:130126914-130126936 CATAGAAGAAAGGAGAATGGGGG + Intronic
1016297281 6:142586876-142586898 TAGAGAAGAAAGCCTAATGGTGG - Intergenic
1016447116 6:144145763-144145785 AAGAAAAAAAAGTAGAATGGTGG + Intergenic
1016680507 6:146823845-146823867 AAGAGAAAGAAACTGAATGGGGG - Intergenic
1016828189 6:148407262-148407284 TACAGACAAAAGTAGAATGGTGG - Intronic
1017362080 6:153585897-153585919 CAGAGACAGAAGCAGATTAGTGG + Intergenic
1017516070 6:155156774-155156796 CAAAGAAAGGAGCAGAAGGGTGG - Intronic
1017612317 6:156201768-156201790 CAGAAACAAAAGTAGAACGGTGG + Intergenic
1017781727 6:157720677-157720699 CAGAGAAATAAGGAGAATCCAGG + Intronic
1017966023 6:159266789-159266811 CAGAGAAAAAATGTAAATGGTGG + Intronic
1018089899 6:160337192-160337214 AAGAGAAACAAGCAGAATTTAGG + Intergenic
1018556166 6:165052560-165052582 GAAAGAAAAAAGCTGAATGGAGG - Intergenic
1018581796 6:165314287-165314309 AAGAGAAAAAAGCAAGGTGGAGG - Intergenic
1018784208 6:167095505-167095527 CAGAGACAAAAGTAGAATAAGGG - Intergenic
1019026267 6:168966125-168966147 CAGAGAAAAGAGGAGAGGGGAGG - Intergenic
1019035981 6:169059000-169059022 CATAGAACAAAGAAGAAAGGTGG - Intergenic
1019377173 7:699038-699060 ATGAGAAAGAAGCAGAAGGGGGG + Intronic
1019584303 7:1789045-1789067 GAGAGAACAAAGCAGAATCCTGG + Intergenic
1020164368 7:5796495-5796517 AAGAGAAAAAAGCGGAAGGAGGG - Intergenic
1020403945 7:7810023-7810045 TATAGAAAAAAGGAGACTGGAGG + Intronic
1020695216 7:11405739-11405761 AAGACAAAATAGCAGTATGGAGG - Intronic
1020967870 7:14895375-14895397 CAATGAAAAAAACATAATGGAGG + Intronic
1020979001 7:15044587-15044609 CAAAGAAAACAGCAGACTAGAGG - Intergenic
1021159541 7:17255140-17255162 TGAAGGAAAAAGCAGAATGGAGG + Intergenic
1021230131 7:18076318-18076340 CATAGCAAAGAGTAGAATGGTGG - Intergenic
1021321480 7:19218146-19218168 CAAAGAAAAAAGAAGAAAGCTGG + Intergenic
1021601834 7:22372145-22372167 AAGAAAAAAATGCAGAATGGTGG + Intergenic
1022770756 7:33470281-33470303 CTGAGAAAAAAAAAGAATGCTGG - Intronic
1023297807 7:38734542-38734564 CAGAGAAATAAGGAGAAAGGGGG - Intronic
1023677668 7:42647464-42647486 CAGAGAATAAAGAAGCAAGGTGG + Intergenic
1023908721 7:44539445-44539467 CAGGGACAAAAGCAAGATGGTGG - Exonic
1024037810 7:45523673-45523695 CAGAGCAAGAGGCAGGATGGTGG + Intergenic
1024076886 7:45825628-45825650 AAGGGAAAAAAGCAGCATGCAGG - Intergenic
1024855763 7:53777050-53777072 TAGAGACAGAAGCAGAATGGAGG - Intergenic
1025033291 7:55574165-55574187 CAGAGAGAGATGCAGAAGGGAGG - Intergenic
1025286487 7:57666611-57666633 CTGTGAAAAAAGAAAAATGGTGG - Intergenic
1026231094 7:68484833-68484855 CAGAGAAAGAAAGACAATGGGGG + Intergenic
1026544063 7:71306412-71306434 CAGAGAAAGAAGAATAGTGGGGG - Intronic
1026692571 7:72562134-72562156 CAGGGAACAAAGGAAAATGGGGG - Intronic
1027158083 7:75782528-75782550 GGGAGAAAAAGGAAGAATGGAGG - Intronic
1027929497 7:84513144-84513166 CAGAGAAAGAAGCACAAGGTTGG + Intergenic
1028460573 7:91087345-91087367 CAAAGAAAAAAACAGAAGAGAGG + Intronic
1028486125 7:91359497-91359519 CAGAGATAGCAGCATAATGGAGG + Intergenic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1028599237 7:92583271-92583293 TAGAAAAGAAAGTAGAATGGAGG + Intronic
1028615494 7:92762140-92762162 CAGAGTAATAATCATAATGGGGG + Intronic
1028903264 7:96124771-96124793 CAGAGAAAATAGCATAATATAGG - Intronic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1029677085 7:102077230-102077252 CAGAGAAAGCAGCAGCAGGGAGG + Intronic
1029884951 7:103858958-103858980 CAGAGAAAGAAGAAGACTGGAGG + Intronic
1030196580 7:106859036-106859058 CAGAGAAGAAAGCAGTACAGAGG + Intergenic
1030377035 7:108764949-108764971 CAGAGACAAATACAGAATGAGGG - Intergenic
1030437107 7:109536340-109536362 CACAGAAAATAGCAGAAATGTGG - Intergenic
1031425452 7:121600012-121600034 CAAACAAGAAAGTAGAATGGAGG - Intergenic
1032272158 7:130419267-130419289 TGGGGAAAAAAGGAGAATGGAGG + Intronic
1032680203 7:134174667-134174689 CAGAGAAGAAAGTGGGATGGTGG + Intronic
1033603359 7:142906702-142906724 AAGAGAATAAAGAAGAATGATGG + Intergenic
1033763311 7:144460719-144460741 CGTAGACAAATGCAGAATGGGGG + Intronic
1033882876 7:145908314-145908336 CAGAAAAAAAAAAAAAATGGTGG + Intergenic
1034310522 7:150083786-150083808 GAGAGAAAACAGCAGTATGGAGG - Intergenic
1034457233 7:151177437-151177459 CAGAGAGGAGAGCAGGATGGTGG - Intronic
1034796317 7:154016844-154016866 GAGAGAAAACAGCACTATGGAGG + Intronic
1034849723 7:154482239-154482261 CAGAGATAAGATCAGAGTGGAGG + Intronic
1035228644 7:157447510-157447532 CAGAGACAGAAGTAGAATGGTGG - Intergenic
1035371683 7:158383263-158383285 CAGAGGCAAAAGCAGCATGCAGG + Intronic
1035412758 7:158658326-158658348 CAGAGCAAATACCTGAATGGGGG + Exonic
1035427619 7:158791132-158791154 CATAGACAGAAGCGGAATGGTGG - Intronic
1035571305 8:674904-674926 CAGGGAAATGAGCAGATTGGAGG - Intronic
1036087200 8:5625342-5625364 CAGAGAAAAATGCGGATAGGAGG - Intergenic
1036536050 8:9653774-9653796 CAGAGAATGAAGCAGAAAGAAGG - Intronic
1037407688 8:18561430-18561452 CATAGAAATAAGGAGAATGGTGG + Intronic
1037450202 8:19009335-19009357 GAGACATAAAAACAGAATGGTGG + Intronic
1037531967 8:19785161-19785183 CAGAGACAAAAGTAGAACAGAGG + Intergenic
1038093255 8:24278431-24278453 CTGAGAATAAATCAGAGTGGTGG - Intergenic
1038144799 8:24885520-24885542 CATAGAAAATGGAAGAATGGGGG - Intergenic
1038176874 8:25188212-25188234 CAGAGATAAAGACAGAGTGGAGG - Intronic
1038348526 8:26755190-26755212 CAGAGAAAAAAAAAAAAAGGAGG - Intronic
1038410958 8:27359597-27359619 CAGAGGAAAAAGCAGAACTCTGG - Intronic
1038432138 8:27508935-27508957 AAAAAAAAAAAGCAGGATGGGGG - Intronic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038961154 8:32521740-32521762 AAGAGAAAAAAGCAGATTCAAGG + Intronic
1040034733 8:42859251-42859273 CAGGGAAAAAAGTAGAAGTGAGG + Intronic
1041085301 8:54251215-54251237 CATAGCAAAAAGCAGAAGGGTGG - Intergenic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1042223864 8:66499784-66499806 AAGAGAAAAAAGCAAATTGCAGG - Intronic
1042312015 8:67388311-67388333 AAGAGAAGAAATCAGAAAGGTGG + Intergenic
1043186207 8:77153472-77153494 CAGAAGAAAATGCAGAAAGGGGG - Intergenic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043513994 8:80979282-80979304 CAGAGTAGAAAACAGAGTGGAGG + Intronic
1043683486 8:83060759-83060781 TAGAGATTAAAGTAGAATGGTGG - Intergenic
1044431816 8:92116433-92116455 CTGAGAAAAAAGAATAAAGGTGG - Intergenic
1044717558 8:95114236-95114258 AAGAGAAGAAAGGAGAAGGGTGG + Intronic
1044759507 8:95503142-95503164 GAGGGAAGAAAGGAGAATGGAGG - Intergenic
1044769332 8:95613539-95613561 TAGAGAAAAAAGTACAATGCTGG - Intergenic
1045997859 8:108384426-108384448 TATAGAACAAACCAGAATGGAGG - Intronic
1046083900 8:109407895-109407917 CAGAAAAGAAGGAAGAATGGGGG - Intronic
1046170911 8:110504391-110504413 GAAAACAAAAAGCAGAATGGTGG - Intergenic
1046350621 8:113006341-113006363 CAGAGTTAAAAGAAGACTGGTGG + Intronic
1046560475 8:115831009-115831031 CAGAGTAAAAAGCCCAGTGGTGG - Intergenic
1046796960 8:118383990-118384012 CTGAAGAAAAAGCAGAATGAAGG + Intronic
1047968765 8:130067045-130067067 CAGAGGAAAATGCAGATTAGAGG - Intronic
1047971976 8:130092248-130092270 CAGAGACAAAAGCAAAAGGCTGG + Intronic
1047987905 8:130255408-130255430 AAGTGAAAAAAGCAGAATACAGG - Intronic
1048774433 8:137930153-137930175 CAGAGCAGAAAACAGAATGAAGG - Intergenic
1049226102 8:141451255-141451277 GAGAGAAAAAAGCAGCGTGGGGG + Intergenic
1050935456 9:11389310-11389332 AGAAGCAAAAAGCAGAATGGTGG + Intergenic
1051306179 9:15712342-15712364 TAGAAAAGAAAGTAGAATGGAGG - Intronic
1051693793 9:19746084-19746106 GAGAAAAAAAAACAGATTGGAGG - Intronic
1051773739 9:20610992-20611014 CAGAGAAATAAGTAAAATGAAGG + Intronic
1051791790 9:20813049-20813071 TAGAGCAGAAAGTAGAATGGTGG - Intronic
1052161597 9:25267677-25267699 AAGAGAAAGAAGAAGAGTGGTGG - Intergenic
1052243179 9:26299899-26299921 CAGATAAAAAGGCAGAAATGTGG - Intergenic
1052427899 9:28328557-28328579 AAAAAAAAAAAGCAGAATGACGG + Intronic
1052777286 9:32744904-32744926 TAGAGTAGAGAGCAGAATGGTGG + Intergenic
1052935463 9:34089249-34089271 CAGACATAAAAGCAAAATCGGGG + Intronic
1053082308 9:35186619-35186641 AAGAGGAAAAAGCTGACTGGTGG + Intronic
1053724681 9:40987479-40987501 GATAGCAAAAAGAAGAATGGAGG - Intergenic
1054341289 9:63864520-63864542 GATAGCAAAAAGAAGAATGGAGG + Intergenic
1054922472 9:70555806-70555828 CAGAGGAAAGGGCAGAATAGAGG - Intronic
1055274081 9:74594569-74594591 GAGAGAAAAAAGCAGAAAGTTGG + Intronic
1055549396 9:77417451-77417473 CAAAGAAAAAAGCATTTTGGGGG - Exonic
1055582373 9:77720593-77720615 CAGAGAAATATGCAGAAGGCAGG - Exonic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1056226304 9:84498704-84498726 CAGAGAAAACAGCAGAGTTCAGG + Intergenic
1056377100 9:86025202-86025224 CAGGAAAATAAGCAGAATGAGGG + Intergenic
1056971374 9:91207408-91207430 CAGAGAAAAGAGCCGAATCTCGG - Intergenic
1056971569 9:91209167-91209189 CAGAGCAACAAGCAGAAGTGGGG + Intergenic
1057056373 9:91964468-91964490 CACCAGAAAAAGCAGAATGGAGG - Intergenic
1057381578 9:94572101-94572123 CAGAGAGAAAGGCAGAATCAGGG - Intronic
1057830660 9:98403634-98403656 CAGACAAAAAAGCAGCCAGGGGG + Intronic
1058624655 9:106922390-106922412 CAAAGTAAATAGCAGAATGAAGG + Intronic
1058884200 9:109310996-109311018 TAGACAAAAAAGTAGAATGGTGG + Intronic
1059385991 9:113964739-113964761 AAAAAAAAAAAGCAGAAAGGAGG - Intronic
1059638882 9:116196741-116196763 AAGAGAAGAAAGGAGAAAGGAGG - Intronic
1060456357 9:123802402-123802424 GTGACAACAAAGCAGAATGGTGG - Intronic
1060589404 9:124807581-124807603 CATTCAGAAAAGCAGAATGGAGG - Intronic
1060613584 9:124990711-124990733 AAAAGAAAAAAGAAAAATGGTGG + Intronic
1060630899 9:125157673-125157695 CAAAAAAAAAAGGAGAATGCTGG - Intronic
1060723685 9:125994203-125994225 CAGAGCTAAGAGCAGGATGGAGG - Intergenic
1060997193 9:127881403-127881425 TAGAAAAAAAAGTAGAATGGTGG + Intergenic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062415648 9:136448280-136448302 CAGAGACACCAGGAGAATGGAGG + Intronic
1062415748 9:136448686-136448708 CAGAGACACCAGGAGAATGGAGG + Intronic
1062480568 9:136749013-136749035 CAGGCCACAAAGCAGAATGGTGG - Intergenic
1203431706 Un_GL000195v1:95708-95730 CAGAGGAAAAAGGAGCACGGAGG - Intergenic
1203434793 Un_GL000195v1:128893-128915 CAGAGGAAAAAGGAGCATGGAGG + Intergenic
1203490327 Un_GL000224v1:98557-98579 CAAAGAAAGGAGCAGACTGGAGG + Intergenic
1203502950 Un_KI270741v1:40438-40460 CAAAGAAAGGAGCAGACTGGAGG + Intergenic
1186239522 X:7551491-7551513 GAGAGAAAAAAGCAATATGAAGG - Intergenic
1186779172 X:12896047-12896069 CACAGGAAAAAGCAGAATTGGGG - Intergenic
1187032277 X:15500233-15500255 CAGAGAAAATAGTGGAATGGGGG + Intronic
1187456859 X:19448919-19448941 GGGAAAAAAAAGTAGAATGGTGG - Intronic
1187521655 X:20019721-20019743 GAGAGAAAAAGGCAGAAGGATGG - Intronic
1188220047 X:27530360-27530382 TATAGAAAACAGAAGAATGGCGG - Intergenic
1188239949 X:27773796-27773818 CAGTGAATGAAGCAGGATGGGGG - Intergenic
1188251094 X:27895892-27895914 GAGACAAAAAAGTAGAATGGTGG - Intergenic
1188385923 X:29557699-29557721 AAGAGCAGAAAGTAGAATGGAGG - Intronic
1188918742 X:35945503-35945525 CAAAGAAAAAAGAAGTATTGGGG - Intronic
1189584354 X:42442822-42442844 CAGATAAAAGGGCAGTATGGTGG + Intergenic
1189737951 X:44090431-44090453 CAAAAAAAAAAGAAGCATGGGGG - Intergenic
1189811702 X:44787126-44787148 CAAAGAAGAAATCAGAAGGGAGG + Intergenic
1190244303 X:48680951-48680973 CCGAGAAAGAAGTAGAAAGGTGG + Intronic
1190250673 X:48722223-48722245 TAAAGGCAAAAGCAGAATGGAGG + Intergenic
1190462856 X:50695946-50695968 CAGAGAACAAAACAGAAAGCAGG + Intronic
1190779924 X:53584049-53584071 CAGATGAAAAAGCATAAGGGAGG + Intronic
1192884156 X:75319654-75319676 ATGAGAAAAAAACAGCATGGGGG - Intergenic
1192986410 X:76404363-76404385 AAAAGTAGAAAGCAGAATGGTGG + Intergenic
1193979817 X:88168716-88168738 CAGAGGAAAAAGCAGAAGCCTGG - Intergenic
1194036008 X:88873176-88873198 CATAGAGAAAGGTAGAATGGTGG + Intergenic
1195421766 X:104683455-104683477 CAGAGAAAGAAGCAGAATGACGG + Intronic
1195529166 X:105932031-105932053 AAGAAAAAAAAGTAGAATAGAGG - Intronic
1195897010 X:109756018-109756040 AAGAGAAAAAAAAAGAGTGGAGG + Intergenic
1196550214 X:117015588-117015610 TAGAGACAAAAGTAGAATAGTGG + Intergenic
1197072783 X:122320867-122320889 CATAGAAATGAGTAGAATGGTGG + Intergenic
1197224317 X:123941277-123941299 CAGAGAAAAAGGAATAAAGGTGG + Intergenic
1197295293 X:124711879-124711901 CATAGAAACAAATAGAATGGTGG - Intronic
1197299891 X:124765139-124765161 TATAGAAAAAAGCAGACAGGAGG + Intronic
1197549391 X:127870261-127870283 AAGAGCAGACAGCAGAATGGTGG + Intergenic
1197894855 X:131301977-131301999 CAATGAAAATAGCAGGATGGGGG + Intronic
1197920262 X:131584725-131584747 AAAAAAAAAAAGCAGAATGGAGG + Intergenic
1197951884 X:131907176-131907198 CAGAGAAAAAGCCACAATGTGGG + Intergenic
1198073055 X:133168675-133168697 GAGAGACCAAAGCAGCATGGAGG - Intergenic
1198863070 X:141091479-141091501 CAGAGAAGAAAAGTGAATGGAGG - Intergenic
1198899620 X:141495908-141495930 CAGAGAAGAAAAGTGAATGGAGG + Intergenic
1200276026 X:154733607-154733629 CAGAGGAAAAACCATAAAGGAGG - Intronic
1201067619 Y:10113090-10113112 CAAAGAAACAAGCAAAACGGAGG - Intergenic
1201669421 Y:16500644-16500666 CATAGAAAAAAACATATTGGAGG + Intergenic
1201697034 Y:16837416-16837438 TGGAGAAAAAAGGTGAATGGGGG - Intergenic
1202088931 Y:21168303-21168325 GAGAGAAAAAAGCAGTATATTGG + Intergenic
1202104397 Y:21347395-21347417 CGGAGAAGAAAGCAGAAAGTAGG - Intergenic