ID: 1172460653

View in Genome Browser
Species Human (GRCh38)
Location 20:35115821-35115843
Sequence TTGTTGTGGATGAAGTTGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 193}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172460644_1172460653 14 Left 1172460644 20:35115784-35115806 CCCATAGGGGGTGATCACCGCGT 0: 1
1: 0
2: 0
3: 0
4: 7
Right 1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG 0: 1
1: 0
2: 2
3: 21
4: 193
1172460638_1172460653 28 Left 1172460638 20:35115770-35115792 CCCAGGATGCACTCCCCATAGGG 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG 0: 1
1: 0
2: 2
3: 21
4: 193
1172460635_1172460653 30 Left 1172460635 20:35115768-35115790 CCCCCAGGATGCACTCCCCATAG 0: 1
1: 0
2: 1
3: 4
4: 115
Right 1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG 0: 1
1: 0
2: 2
3: 21
4: 193
1172460643_1172460653 15 Left 1172460643 20:35115783-35115805 CCCCATAGGGGGTGATCACCGCG 0: 1
1: 0
2: 0
3: 0
4: 17
Right 1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG 0: 1
1: 0
2: 2
3: 21
4: 193
1172460636_1172460653 29 Left 1172460636 20:35115769-35115791 CCCCAGGATGCACTCCCCATAGG 0: 1
1: 0
2: 1
3: 14
4: 119
Right 1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG 0: 1
1: 0
2: 2
3: 21
4: 193
1172460640_1172460653 27 Left 1172460640 20:35115771-35115793 CCAGGATGCACTCCCCATAGGGG 0: 1
1: 0
2: 0
3: 2
4: 94
Right 1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG 0: 1
1: 0
2: 2
3: 21
4: 193
1172460648_1172460653 -3 Left 1172460648 20:35115801-35115823 CCGCGTCGAAGGTGGACCCATTG 0: 1
1: 0
2: 0
3: 1
4: 22
Right 1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG 0: 1
1: 0
2: 2
3: 21
4: 193
1172460645_1172460653 13 Left 1172460645 20:35115785-35115807 CCATAGGGGGTGATCACCGCGTC 0: 1
1: 0
2: 0
3: 1
4: 15
Right 1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG 0: 1
1: 0
2: 2
3: 21
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172460653 Original CRISPR TTGTTGTGGATGAAGTTGGT TGG Exonic
901142862 1:7046450-7046472 TTCTTGTGGCTGAAATTGGCAGG + Intronic
901848346 1:11999030-11999052 TTGTTCAGGATGAAGATGTTTGG - Exonic
904477419 1:30774263-30774285 TTGTTGTGTTTGAGGTTGGTTGG + Intergenic
904994470 1:34620621-34620643 TTCTTGTGGCTGAACTTGCTTGG - Intergenic
906146741 1:43565048-43565070 CTGTTGTGGGGGAAGGTGGTGGG - Intronic
910160496 1:84267329-84267351 TTGGTGGGGGTGACGTTGGTAGG - Intergenic
910160500 1:84267344-84267366 TTGGTGGGGGTGAGGTTGGTGGG - Intergenic
911962137 1:104318914-104318936 AGGTTCTGGATGAAGTTGGTGGG + Intergenic
912316102 1:108668704-108668726 ATGTTGTGTCTGGAGTTGGTGGG - Intergenic
914395174 1:147259854-147259876 TTGTTGTGGATGAAGCTCACAGG + Exonic
917238276 1:172918280-172918302 TTGTTCTGGGTGGAGGTGGTAGG - Intergenic
917693920 1:177499079-177499101 TTTTTTTGGATGGAGTTTGTAGG - Intergenic
917913761 1:179679000-179679022 TTTTTGTAGATGCTGTTGGTAGG + Intronic
921258512 1:213364464-213364486 TGGTTGTGGTTGTTGTTGGTGGG + Intergenic
921672229 1:217938289-217938311 TAGTTGGGCATGGAGTTGGTGGG - Intergenic
923057582 1:230438775-230438797 GTTTTGTGAGTGAAGTTGGTGGG + Intergenic
923218600 1:231873037-231873059 TTGCTGTGGAAGAAGATGGTGGG + Intronic
923892907 1:238235527-238235549 TTGTTGTGGGGGGAGTGGGTGGG - Intergenic
1065648742 10:27865045-27865067 TTGCTGTGGAAGAATTTGGTGGG - Intronic
1067164326 10:43853091-43853113 GGGTTGTGGATGGAGTTGATGGG + Intergenic
1068015395 10:51509916-51509938 TTATTGGGGTTGAAGTTGGGTGG + Intronic
1069135032 10:64753330-64753352 TGCTTGTGGATGAATCTGGTGGG + Intergenic
1069602483 10:69716945-69716967 TTGTGGTGGATGGTGTCGGTGGG - Intergenic
1070207902 10:74282943-74282965 TTGTTCTGGATGACAATGGTAGG + Intronic
1072941367 10:99767106-99767128 TTGTTGTCGATGTTTTTGGTGGG + Intergenic
1074443009 10:113495143-113495165 TTGCTGTGGCTGAATTTGGGGGG + Intergenic
1074645578 10:115448850-115448872 TTGTTGTTGTTGTTGTTGGTTGG - Intronic
1075526420 10:123190879-123190901 GTGCTGTGGATGAAGTCCGTTGG + Intergenic
1076006378 10:126950905-126950927 TTATTGTTGATGATGGTGGTTGG + Intronic
1079261508 11:18886978-18887000 TTGAGGTGGATGAAGGTGGAGGG - Intergenic
1079405705 11:20143782-20143804 TTGTAGGGGCTGAAGTTGGTGGG + Intergenic
1080556455 11:33421730-33421752 TTCCTGGGGATGGAGTTGGTGGG + Intergenic
1081095818 11:38933339-38933361 TTGTTGTTGTTGTTGTTGGTAGG + Intergenic
1081329430 11:41786272-41786294 TTGTTGTGGTTGTAGTGGCTTGG - Intergenic
1081374128 11:42339294-42339316 TTCTTGTGAATGAAGATGGAAGG - Intergenic
1082083417 11:48029574-48029596 TTAATGTGGATTAAGTTAGTTGG + Intronic
1085633508 11:78139609-78139631 CGGATGTGGATCAAGTTGGTGGG - Exonic
1085664356 11:78400286-78400308 TTGGTGTGGAAGAAGTTGGAGGG - Intronic
1086342132 11:85857485-85857507 TTGGTGTGGATGAGGTTGGTGGG - Intronic
1086864224 11:91960143-91960165 TTGTTTTGGCTTGAGTTGGTTGG - Intergenic
1089653727 11:119932258-119932280 TTGACGTGCATGAAGTTAGTTGG + Intergenic
1091520414 12:1234550-1234572 TTTTTGTTGCTGTAGTTGGTTGG + Intronic
1091776998 12:3191149-3191171 TTGATGTGGGTTAATTTGGTGGG + Intronic
1094816314 12:34188967-34188989 TTCTTGCAGTTGAAGTTGGTTGG - Intergenic
1095426615 12:42081359-42081381 AGGTTCTGGATGAAGTTAGTGGG - Intergenic
1096332272 12:50724222-50724244 TTGCTGTTGATGCAGTTCGTGGG + Intronic
1096749253 12:53748301-53748323 GTGTTGGGGATGGAGTTGGGGGG - Intergenic
1096956407 12:55530230-55530252 TTGTAGTGGCTTGAGTTGGTTGG - Intergenic
1097054982 12:56243780-56243802 TGGCTGTGGATGAAGAAGGTGGG - Exonic
1097339149 12:58417578-58417600 TTGTTGATGGTGAAGTTGGAAGG + Intergenic
1097686821 12:62698998-62699020 GTGATGTGGATGAAGATGGCAGG - Intronic
1098507376 12:71269273-71269295 TTGTTATTGAGGAAGGTGGTGGG - Intronic
1099744653 12:86686972-86686994 TTGTTGTTGTTGTTGTTGGTAGG + Intronic
1103846052 12:123902676-123902698 TTGTCCTGGATGGAGTGGGTGGG + Intronic
1104828547 12:131732443-131732465 ATGTAGTGTATGAGGTTGGTGGG + Intronic
1107669562 13:42730395-42730417 TTATTGTGGATGAGGGTGGTGGG + Intergenic
1107775981 13:43841715-43841737 TTGTTGTTGTTGAAGTGGGGAGG + Intronic
1111526138 13:89473361-89473383 TTGTTGTTGTTGTTGTTGGTAGG + Intergenic
1111818896 13:93190216-93190238 CTGTTGTGGCTGAAAATGGTAGG - Intergenic
1112004950 13:95245881-95245903 TTGTTGGGAATGAGGTGGGTGGG - Intronic
1113128919 13:107012964-107012986 TTGTTTTTGATGAACTTGATAGG + Intergenic
1116317634 14:43417811-43417833 CTGTTGGGGAGGAGGTTGGTTGG + Intergenic
1116614217 14:47113310-47113332 TTGTTGTTGTTGTTGTTGGTAGG - Intronic
1117100746 14:52344091-52344113 ATGTTGTAGATAAATTTGGTTGG - Intergenic
1117733575 14:58747602-58747624 TTGTTGTTGTTGTTGTTGGTTGG + Intergenic
1120213549 14:81658204-81658226 CTGTTGTGGATAAGGGTGGTGGG + Intergenic
1120564234 14:86035185-86035207 TTGTTGTGTGTGAATTTGGCAGG + Intergenic
1121098865 14:91236034-91236056 TTGCTGTGGATGAAGGTGGCCGG - Intronic
1121350484 14:93169304-93169326 ATGTTGTGCCTGAAATTGGTGGG + Intergenic
1122661053 14:103295287-103295309 TTGTTTTGGTTGAAGTTTGTGGG - Intergenic
1123215907 14:106809312-106809334 TTGTCCTAGATGAACTTGGTCGG + Intergenic
1124073685 15:26421189-26421211 TTGTTGTGGCTGAAATTTCTGGG + Intergenic
1125220718 15:37331077-37331099 CTGCTGGGGATGAAATTGGTTGG + Intergenic
1125460309 15:39900356-39900378 TTGTTGTGGATGAAGAATGTAGG - Intronic
1126508339 15:49435088-49435110 TTGTTGTGTATGAAGTGAGAGGG + Intronic
1127652935 15:61026808-61026830 TTGTTCTGGGAGAAGTTGCTAGG + Intronic
1130089606 15:80809489-80809511 TTGTTCTGGATGAAACTGATAGG + Intronic
1131371152 15:91882936-91882958 TTGTTCTTTAAGAAGTTGGTTGG + Intronic
1133734399 16:8603053-8603075 TTGTTGTTGTTGTCGTTGGTTGG + Intergenic
1133970305 16:10563014-10563036 TTGATGTGGATTACGTTGCTCGG + Intronic
1135138208 16:19900280-19900302 TGCTTGTGGCTGAAGTTGCTTGG + Intergenic
1136274956 16:29174050-29174072 TTGTTGTTGATGCTGTTGTTTGG - Intergenic
1136294073 16:29291830-29291852 TCGGTTTGGATGAAGGTGGTTGG + Intergenic
1136715069 16:32273231-32273253 TTGTTGTTGTTGTTGTTGGTAGG - Intergenic
1136752846 16:32656500-32656522 TTGTTGTTGTTGTTGTTGGTAGG + Intergenic
1136815268 16:33213865-33213887 TTGTTGTTGTTGTTGTTGGTAGG - Intronic
1136821744 16:33323945-33323967 TTGTTGTTGTTGTTGTTGGTAGG - Intergenic
1136828307 16:33380484-33380506 TTGTTGTTGTTGTTGTTGGTAGG - Intergenic
1136833373 16:33479256-33479278 TTGTTGTTGTTGTTGTTGGTAGG - Intergenic
1136873472 16:33828768-33828790 TTGTCCTAGATGAACTTGGTCGG - Intergenic
1137544110 16:49387688-49387710 TTGTTGTCGTTGTAGTTGGTAGG + Intronic
1140604725 16:76522104-76522126 TGGTTGTCGTTGAAGTGGGTGGG - Exonic
1141321815 16:83017934-83017956 TTTTTGTGAATCAAGTAGGTTGG + Intronic
1142079270 16:88139931-88139953 TTGTTGTTGATGCTGTTGTTTGG - Intergenic
1142099974 16:88265876-88265898 TTGGTTTAGATGAAGGTGGTTGG + Intergenic
1142156936 16:88536865-88536887 TTGTTGTGCATGAATTTGCGTGG + Exonic
1202993845 16_KI270728v1_random:36840-36862 TTGTTGTTGTTGTTGTTGGTAGG - Intergenic
1203011543 16_KI270728v1_random:245265-245287 TTGTTGTTGTTGTTGTTGGTAGG + Intergenic
1203054983 16_KI270728v1_random:916538-916560 TTGTTGTTGTTGTTGTTGGTAGG + Intergenic
1203098703 16_KI270728v1_random:1287287-1287309 TTGTCCTAGATGAACTTGGTCGG + Intergenic
1148289144 17:46427697-46427719 TTATTCTGGATGAAGTTTCTGGG + Intergenic
1148311313 17:46645274-46645296 TTATTCTGGATGAAGTTTCTGGG + Intronic
1159726271 18:71963673-71963695 TTGTTGGGGAAGAACTTTGTGGG - Intergenic
1161150573 19:2706172-2706194 TTGTTGATGATGATGTTGTTTGG + Intergenic
1161451714 19:4350064-4350086 TTGTGGGGGAAGAAGGTGGTTGG + Intronic
1162896261 19:13766205-13766227 TTTTTGTGGATAAAGTGGTTTGG - Intronic
1163111713 19:15165363-15165385 ATGCTGTGGATGAGCTTGGTAGG - Exonic
1164331499 19:24262803-24262825 TTGTTTTTGATTAAGTAGGTTGG - Intergenic
1166585041 19:43938106-43938128 TGGTTGGGGATGCAATTGGTTGG + Intergenic
927573097 2:24177000-24177022 TAGATGTGGATGATGTTGTTTGG + Intronic
928167617 2:28982198-28982220 TTGTTGTTGATGCTGTTGTTAGG + Intronic
931110870 2:59110237-59110259 TTGTTGTTGTTGTTGTTGGTTGG - Intergenic
931434132 2:62232466-62232488 TTGTTGGGCTTAAAGTTGGTGGG + Intergenic
932586771 2:73035234-73035256 TTGGTGTGGATGGAGGAGGTGGG - Intronic
933406310 2:81864484-81864506 TTTTTGTGGATGAAATTGTTAGG - Intergenic
933541285 2:83645941-83645963 TTACTGTGGATGAAGTGGGTAGG + Intergenic
934994372 2:98943617-98943639 ATGATGTGGATGATGGTGGTAGG - Intergenic
935125464 2:100218643-100218665 TTGTTTTTGATGCAGTAGGTGGG - Intergenic
936018609 2:108978005-108978027 GTTCTGTGGATGAAGTTGGCTGG - Intronic
937740705 2:125349586-125349608 ATGTTGGGGAGGAAGCTGGTGGG - Intergenic
938779015 2:134567788-134567810 TAGTTGTGGATGATGTTAATGGG + Intronic
942784447 2:179684742-179684764 TTATTGTGGATGAACTAGGTAGG - Intronic
944443017 2:199761698-199761720 GTGTAGTGGATGAAGATGTTGGG - Intronic
945683803 2:212944802-212944824 TTGTTGGGGATGTTGTTGATGGG + Intergenic
948469002 2:238165541-238165563 GTGTCGTAGGTGAAGTTGGTGGG + Intronic
1169640692 20:7747532-7747554 TTGTTGAAGATGAGGCTGGTGGG + Intergenic
1169724183 20:8711598-8711620 CTATTGTGGAGGAAGTGGGTGGG + Intronic
1169895886 20:10504523-10504545 TTGTTGTAGAGGAAGTAGGAGGG + Intronic
1170225867 20:13991659-13991681 TTGTTCTGGATCATGTTGGTGGG - Intronic
1170290766 20:14765740-14765762 TTGTTCTGGATGAAGTAGGTTGG + Intronic
1172460653 20:35115821-35115843 TTGTTGTGGATGAAGTTGGTTGG + Exonic
1173905912 20:46628568-46628590 TTGATATGGATGAGGTTGGGAGG + Intronic
1175443278 20:59005154-59005176 TTGATGTGGATGGAGCTGGAAGG - Intronic
1176969995 21:15253987-15254009 TTGGTGTGGAGGATGGTGGTAGG - Intergenic
1177989621 21:28021547-28021569 TTTTTTTGGATGAAGATAGTGGG - Intergenic
1178189253 21:30261930-30261952 TTGATTTGGAAGAAGTAGGTGGG - Intergenic
1180247369 21:46557193-46557215 TGTTTGGGGATGAAGTGGGTTGG + Intronic
1181800754 22:25346241-25346263 ATGTTGTGTCTGAAATTGGTGGG + Intergenic
1182044126 22:27261053-27261075 TTATTTTGGATGATGTCGGTTGG + Intergenic
951285378 3:20806026-20806048 TACTTGTGGTTGAAGTTGGATGG + Intergenic
952821705 3:37491623-37491645 TTGTTGGGGATGTTGTTTGTGGG + Intronic
953215821 3:40917183-40917205 TTTTTGTGGGTGAAGTGGGTAGG - Intergenic
953651651 3:44810868-44810890 TGGTCGGGAATGAAGTTGGTAGG - Exonic
957904749 3:86541218-86541240 TACTTGTGGGTGAAGTTGGGGGG + Intergenic
962300081 3:134231993-134232015 TTGGTATGGATGAAGATTGTTGG - Intronic
963233844 3:142936316-142936338 TTGTTGTGGATAAGGCAGGTAGG + Intergenic
963570094 3:146982654-146982676 TTGGTGTAGATTAAGTGGGTTGG - Intergenic
964495356 3:157283543-157283565 GTGTTGATGGTGAAGTTGGTGGG + Intronic
965080330 3:164024438-164024460 GTCTTGTGGATGAAGATAGTCGG + Intergenic
974089088 4:57291849-57291871 TAGTTATGTATGAAGTTTGTTGG - Intergenic
974496336 4:62633378-62633400 TTGTTGTTGGTGTTGTTGGTAGG - Intergenic
976044631 4:80930649-80930671 TTGTTGTGGGTGAAAGTGGAGGG + Intronic
976253208 4:83074257-83074279 TTGTTGTGGTTGAGGTTGTTGGG + Intronic
978013320 4:103713709-103713731 TGGTTCTGGATGAGATTGGTTGG + Intronic
978407880 4:108398983-108399005 TAGATGTGAATGAAGTGGGTGGG + Intergenic
979736893 4:124097853-124097875 TTGTTGTGCCTGAAGTTAGATGG - Intergenic
979945369 4:126824866-126824888 TTGTTGTTGTTGTTGTTGGTTGG + Intergenic
980334803 4:131457707-131457729 TTGGTGTGCATAAAGTTGATGGG - Intergenic
984475768 4:180232539-180232561 ATGTTGTGAATGTAGTTGGAAGG - Intergenic
988242501 5:28632213-28632235 TTGTTGTAGTTGTTGTTGGTTGG - Intergenic
988389505 5:30609507-30609529 GTGTTGTGGAGGAACCTGGTGGG - Intergenic
989522946 5:42422927-42422949 TTCTTGTGAATGAAGTAGGCAGG + Intergenic
992424194 5:76638879-76638901 TTGCTTTGTCTGAAGTTGGTGGG + Intronic
993641160 5:90408160-90408182 TTTTTTTGGTTGGAGTTGGTTGG - Intronic
999590899 5:153143950-153143972 TAGTAGTAGATCAAGTTGGTGGG - Intergenic
1001144560 5:169172384-169172406 GTGTTTTGGATGCATTTGGTGGG - Intronic
1002876967 6:1219236-1219258 TTGCTGTGGTTGAAGTGGGGTGG - Intergenic
1003309386 6:4956206-4956228 TTCTTGTGCAAGAAGTTGGAAGG - Intergenic
1005559283 6:27021081-27021103 TTGTTGTGGCTGAGGTGGGTAGG + Intergenic
1005621252 6:27622640-27622662 CTGATGTGGATGAACTTGGTTGG - Intergenic
1006166210 6:32067199-32067221 TTCTAGTGGAGGAAGTGGGTGGG + Intronic
1006782216 6:36639695-36639717 TTGCTGTGGTTGAAGCAGGTGGG - Intergenic
1008456056 6:51712072-51712094 TTTCTGTGGAGGAAGTTGGGTGG - Intronic
1010411343 6:75565811-75565833 TTGTTGTTGTTGTTGTTGGTAGG - Intergenic
1013208517 6:107966158-107966180 TTGTTGTGGAGGCTGTGGGTTGG - Intergenic
1013302313 6:108815732-108815754 TTGTTGTTGTTGTTGTTGGTAGG + Intergenic
1015771588 6:136773626-136773648 TTGTTGTTGTTGTTGTTGGTTGG + Intronic
1016790070 6:148059165-148059187 TTGTTGTTGTTGTTGTTGGTAGG + Intergenic
1017334865 6:153244348-153244370 TTGTTGTCAATGGAGATGGTGGG + Intergenic
1020680121 7:11226481-11226503 TTGGTGGGGATGAGGCTGGTGGG + Intergenic
1024987626 7:55209043-55209065 TTGTGTAGGATGAAGCTGGTGGG + Exonic
1026010441 7:66631608-66631630 TTGATCTGGAGGAAGTTTGTGGG + Intronic
1029925681 7:104313933-104313955 TTGTAGATGATGAAGTGGGTGGG + Intergenic
1032428579 7:131842103-131842125 TGGTTTAGGAAGAAGTTGGTGGG + Intergenic
1032750447 7:134834779-134834801 TTGGTAGGGATGAAGTGGGTTGG - Intronic
1034054036 7:148015677-148015699 CTGTTGAGGATGAAAGTGGTTGG - Intronic
1037205192 8:16308691-16308713 TTGTTGTTGTTAAATTTGGTAGG + Intronic
1041073273 8:54145845-54145867 CTGTTGTAGGTGAAGTAGGTAGG + Intronic
1042221987 8:66483273-66483295 ATGTGGTGGAGGAAGTTGCTGGG - Intronic
1043064243 8:75546513-75546535 TTGTTGGGGAGGGAGTTGGGAGG - Intronic
1044953964 8:97460601-97460623 TTGGTGTGGATAAAGGTGGATGG - Intergenic
1046227625 8:111305746-111305768 TTGTTGTTGTTGCTGTTGGTGGG + Intergenic
1047900441 8:129415682-129415704 TTGTGCTGTGTGAAGTTGGTAGG + Intergenic
1048477081 8:134753228-134753250 TTGTTGTTGTTGTTGTTGGTTGG - Intergenic
1048709016 8:137187124-137187146 TTGTTGTTGATGACGATGATGGG - Intergenic
1050008143 9:1156673-1156695 TTGTTGTGGTTTGATTTGGTTGG - Intergenic
1050147825 9:2588726-2588748 TTGGTGTGGATGAAGTGGTCAGG + Intergenic
1052585357 9:30421274-30421296 TTATTCTTGATAAAGTTGGTGGG + Intergenic
1053400187 9:37812241-37812263 TTGTTTTTGAAGAAGTTGGTAGG - Intronic
1053584258 9:39439858-39439880 TTGTTCTGAATGAAGTTAATTGG + Intergenic
1054105838 9:60998604-60998626 TTGTTCTGAATGAAGTTAATTGG + Intergenic
1054732656 9:68716406-68716428 TTGTTAAGGAAGAAGTTAGTTGG + Intronic
1056241975 9:84656806-84656828 TTGGTGTGGAAGAAGATGGAAGG + Intergenic
1059076947 9:111203464-111203486 TTGTTGTTGTTGTTGTTGGTAGG - Intergenic
1060316953 9:122520476-122520498 TTGTTGTTGCTGATGGTGGTGGG + Intergenic
1188447533 X:30271737-30271759 TTATTGTAAATAAAGTTGGTTGG - Intergenic
1188797153 X:34481258-34481280 CTGCTGTGGGTGAAGGTGGTGGG + Intergenic
1189152436 X:38722075-38722097 TTGTTGTTGTTGAAGTTTGAGGG - Intergenic
1191018392 X:55835046-55835068 TTCATGTGGTAGAAGTTGGTGGG + Intergenic
1193652458 X:84154645-84154667 GTGGTGGTGATGAAGTTGGTGGG - Intronic
1193703697 X:84794224-84794246 TTGTTGTTGTTGTTGTTGGTAGG - Intergenic
1196353055 X:114755538-114755560 TTATTCTGGATGATGTAGGTGGG - Intronic
1196824648 X:119731559-119731581 GGGGTGGGGATGAAGTTGGTAGG + Intergenic
1197918548 X:131562874-131562896 TTGTTGTGGTTAAAGTTGATGGG + Intergenic
1198798082 X:140420888-140420910 TTGATATGGTTGGAGTTGGTTGG + Intergenic
1199345575 X:146734756-146734778 TTGTTGGGGCTGCAGTTGCTGGG - Intergenic
1201066690 Y:10103354-10103376 TTCTTGCGGTTGCAGTTGGTTGG + Intergenic