ID: 1172461149

View in Genome Browser
Species Human (GRCh38)
Location 20:35119771-35119793
Sequence TCATCTGGACCCACTCCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172461149_1172461151 0 Left 1172461149 20:35119771-35119793 CCAACAGGAGTGGGTCCAGATGA No data
Right 1172461151 20:35119794-35119816 GAATATTTATTCTAGAGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172461149 Original CRISPR TCATCTGGACCCACTCCTGT TGG (reversed) Intronic