ID: 1172461986

View in Genome Browser
Species Human (GRCh38)
Location 20:35126120-35126142
Sequence TTGGAGGGACAGGTTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 467}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172461986 Original CRISPR TTGGAGGGACAGGTTGAGGA TGG (reversed) Intronic
900622107 1:3592225-3592247 TGAGAGGGGCAGCTTGAGGAAGG + Intronic
901594110 1:10371207-10371229 AGAGAGGGACAGGTGGAGGAGGG - Exonic
901646008 1:10717072-10717094 CTGGAGGGACAGGAGCAGGAGGG + Intronic
902511044 1:16967351-16967373 ATAGAGGGACAGGCTGGGGAGGG - Intronic
902776025 1:18675574-18675596 TTGGGGGGACAGCCTGAGAAGGG - Intronic
902777288 1:18682919-18682941 GTGCAGGGACAGGTGGAGAAGGG - Intronic
902777680 1:18685019-18685041 GAGGAGGGAAAGGTTGGGGATGG + Intronic
902828299 1:18992700-18992722 GTGGAGAAACAGGTTGAGGCTGG - Intergenic
902969156 1:20034132-20034154 TTGGATGGACAGGTTAAAGGAGG + Intronic
903733480 1:25515146-25515168 TTGGAGAGGCAGGTGGAGAATGG - Intergenic
904652016 1:32013271-32013293 CTGGAGGGAGAAATTGAGGAAGG - Intergenic
904709474 1:32417989-32418011 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
905153315 1:35950546-35950568 TTGGGGGGCCAAGTTGGGGAAGG + Intronic
905349602 1:37336082-37336104 TAGGAGGCAGAGGTTGAGGTGGG + Intergenic
905520901 1:38598942-38598964 GTGGAGGGAGAGGTGGAGGCAGG - Intergenic
906001028 1:42425121-42425143 TTGGAGGTAAGGGTTGAGGAAGG - Intergenic
906384943 1:45359788-45359810 TTGGAGGCAGAGGTTGCGGTGGG + Intronic
907394308 1:54178596-54178618 ATGGAGGGACAGGCTGAGGTGGG + Intronic
907537796 1:55180739-55180761 TGTGAAGGAGAGGTTGAGGATGG - Intronic
908403900 1:63795097-63795119 TTGGGAGGGCAGGTTCAGGAAGG + Intronic
909028562 1:70511471-70511493 TTGGTGGGGCAGGATCAGGAGGG + Intergenic
909584820 1:77278409-77278431 TAGCAGGAACAGGGTGAGGAAGG - Intergenic
909978510 1:82071407-82071429 TTGCTGGGACAGGTTGGGGAGGG + Intergenic
910410874 1:86943473-86943495 TTGGAGGCTGAGGTTGAGGCTGG + Intronic
912419876 1:109535724-109535746 GTGGAGGGACAGGCTGATGATGG + Intergenic
912581218 1:110722646-110722668 TGTGAGGCAGAGGTTGAGGAGGG + Intergenic
913017067 1:114748786-114748808 TTTGAGGGAAAGGCTGAGGATGG - Intronic
914255861 1:145960976-145960998 TGGGTGGGACTGGTTGAGGAGGG + Exonic
916286803 1:163115140-163115162 TTGGAGGGTGGGGTTGAGGGAGG + Intronic
916671305 1:167023466-167023488 TTGGATGGAGAAGATGAGGAAGG + Intergenic
917711221 1:177687455-177687477 TTCCAGGGATAGGATGAGGATGG - Intergenic
920002823 1:202811232-202811254 TTGGATGGACCGAATGAGGATGG - Intergenic
920094785 1:203479234-203479256 TTGTATGGAGAGGTTGAGGTTGG - Intronic
922377913 1:224988048-224988070 TTGGAGGTAGAGGTGGGGGAGGG - Intronic
922469631 1:225867973-225867995 CTGGAAGGACAGGTAGTGGATGG + Exonic
922476083 1:225907762-225907784 TGAGAGGGGCAGGGTGAGGAGGG - Intronic
923872254 1:238008463-238008485 TTGGAGGGACAGGCTAATGGGGG + Intergenic
923978839 1:239297250-239297272 TTGGAAGCAGAGCTTGAGGAGGG + Intergenic
924676564 1:246184472-246184494 TCTGAGGTACAGATTGAGGATGG - Intronic
1062998142 10:1888019-1888041 TTGGGGGGAAAGGGTGAGAAAGG - Intergenic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063707883 10:8448767-8448789 TGGGAGGAGCAGGTTGAGGTGGG - Intergenic
1064556559 10:16552395-16552417 TTGCAGGAAAATGTTGAGGAAGG + Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067286638 10:44912046-44912068 CTGGAGGGACAGGCTGAGCCTGG + Intronic
1067742354 10:48905241-48905263 ATAGAGGGGCAGGTAGAGGAGGG + Intronic
1068496761 10:57792532-57792554 TTGGAGGAACAGGGCCAGGAAGG - Intergenic
1068535513 10:58236962-58236984 TAGGAGGCACAGGCTGAGGTGGG + Intronic
1068730762 10:60355721-60355743 CTGGAGGGAGATGTTGGGGAAGG - Intronic
1069685135 10:70313035-70313057 TTGGAGGGAAAGGCTGTGGTGGG - Intronic
1069820265 10:71223116-71223138 TTGGGGAGACAGGTTCAGCAGGG + Intronic
1070179060 10:73997669-73997691 GTGAAGGGAAAAGTTGAGGAGGG + Intergenic
1070563428 10:77585025-77585047 TTTGAGGGACAGCTTGGAGAAGG - Intronic
1070673325 10:78393473-78393495 TTGGATGGAAAGGTCCAGGATGG + Intergenic
1070829507 10:79409850-79409872 TTGGAGGAGCAGGGGGAGGACGG + Intronic
1071564519 10:86664867-86664889 TTGGAGGGATAGGCTCAGGGGGG + Intronic
1071715857 10:88094630-88094652 TTGGAGGAAAGAGTTGAGGATGG - Intergenic
1072164354 10:92798555-92798577 TTTGAGGGAAAGGTGGAAGAGGG + Intergenic
1072482579 10:95823411-95823433 TGGGTGGGACAGGGGGAGGAGGG + Intronic
1072693450 10:97586472-97586494 GTGGAGGGCCACGTTGAGCAGGG + Intronic
1073078277 10:100838351-100838373 TTGAAGGGAAAGTTTGAGGCAGG + Intergenic
1073208821 10:101782484-101782506 TTGGCAGGACAGCTTGAGGTTGG + Exonic
1073297367 10:102449428-102449450 TTGGAGGGAGATGGTGAAGAGGG + Intergenic
1073938084 10:108659003-108659025 TTGGATGAACAGGATGTGGATGG + Intergenic
1074375628 10:112938814-112938836 CTGAAGGGACAGGGAGAGGAGGG + Intergenic
1075183551 10:120233956-120233978 GGGGTGGGACTGGTTGAGGATGG + Intergenic
1075400153 10:122155213-122155235 CTGGAGAGGCAGGTTGAGAAGGG - Intronic
1075762100 10:124864747-124864769 TGGGAGGGAGGGGTAGAGGAAGG - Intergenic
1075835010 10:125445544-125445566 GAGAAGGGACAGGTTGTGGATGG - Intergenic
1076014250 10:127015123-127015145 TGGGAGGGAGAGTTTGAAGAAGG - Intronic
1076146218 10:128124901-128124923 TTGGGAGGACAGGGTGAGGCCGG + Intronic
1076217443 10:128707414-128707436 TTGGAGGTAAAGGGTGAGGATGG + Intergenic
1077015913 11:399209-399231 GAGGAAGGACAGGTGGAGGAGGG - Intronic
1077125457 11:933472-933494 TGGGTGGGATAGGTTGAGGTGGG + Intronic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077324004 11:1955861-1955883 TTGGATGGACAGGTTCAGCATGG + Intronic
1077497508 11:2893337-2893359 TTGGAGGGAGAGGCTGATGATGG - Intronic
1079475052 11:20821267-20821289 TTCTAGAGACAGGTAGAGGAAGG - Intronic
1079524290 11:21365803-21365825 TTTGGGGGAGAGGTTGAGGGGGG + Intronic
1079646638 11:22871053-22871075 TTGGAGAGATGGGTAGAGGAAGG - Intergenic
1080231165 11:30018290-30018312 CTGGAGTTACAGTTTGAGGAAGG + Intergenic
1080709912 11:34737090-34737112 TTGGAGGGCAAGGTGGAAGATGG + Intergenic
1080753935 11:35177329-35177351 TTGGAGCCATAGTTTGAGGAAGG - Intronic
1082713491 11:56584479-56584501 ATGGAGGGACAGTTTTGGGAAGG - Intergenic
1082731024 11:56797879-56797901 GTGCAGTCACAGGTTGAGGAGGG - Intergenic
1083227150 11:61292508-61292530 GTTGAGGGAAAGGTTGAGAAGGG + Intronic
1083490183 11:63009924-63009946 GAGGAGGGCCAGGCTGAGGAGGG + Intronic
1083729327 11:64644394-64644416 ATGGAGGGAGAGGTTGGGGCTGG - Intronic
1084066695 11:66708323-66708345 TGGAAGGGACAGGGTGGGGAGGG + Intronic
1084096691 11:66915995-66916017 TTGGAGGGTAAGGAGGAGGAAGG - Intronic
1084288224 11:68145600-68145622 TGGGAGGGGCAGCTTCAGGATGG + Intergenic
1084785393 11:71438942-71438964 TGCGAAGGACAGGTTGATGAGGG + Exonic
1084968367 11:72756134-72756156 TTGGAAGGACAGGCAGGGGAGGG - Intronic
1085097139 11:73770450-73770472 TTGCAGTGACAGATTTAGGATGG - Intergenic
1085125889 11:74002127-74002149 GTGGAGGGACAGGCTGAGAGAGG - Intronic
1085171058 11:74450388-74450410 TTGGAGGGAGGGGGTGAAGACGG - Intergenic
1085415896 11:76318823-76318845 TTGGAGGGGTAGGGTGGGGATGG - Intergenic
1085687657 11:78638841-78638863 GTGGAGGGACAGGTGCAGGTGGG + Intergenic
1085699383 11:78732583-78732605 TGGGAGGGGAAGGTTGAGAAGGG + Intronic
1086324343 11:85682847-85682869 TTGGACGTACAGGTTGTGGGAGG + Intronic
1086370691 11:86152647-86152669 CTAGAGTGACAGGTGGAGGAAGG - Intergenic
1086860854 11:91923323-91923345 TTGGAGGGACAGGATGTGTTGGG - Intergenic
1087469370 11:98551835-98551857 TCAGAGGGAAAGGTTGAGAAGGG + Intergenic
1087608434 11:100405477-100405499 TCAGAGGGACAGCTTGAGGGTGG - Intergenic
1088298134 11:108323405-108323427 GTGGAGGGAGAGGATGAAGAGGG + Intronic
1088720836 11:112590567-112590589 TCGGAGGGACTGTCTGAGGAAGG + Intergenic
1089372572 11:117971856-117971878 TTTGGGGGTCAGGGTGAGGAGGG - Intergenic
1089985640 11:122810276-122810298 TTGAAAGGACAGCTTGGGGATGG + Exonic
1090072265 11:123554260-123554282 TTGGAGGAATAACTTGAGGAAGG + Intronic
1090464488 11:126922246-126922268 ATGGAGGGGCCAGTTGAGGAGGG - Intronic
1090887862 11:130895124-130895146 TGGGAGGCCCAGGTTGTGGAGGG + Intronic
1091068109 11:132536139-132536161 CTGGAGGGACAGGATGCTGAGGG - Intronic
1202806990 11_KI270721v1_random:11056-11078 TTGGATGGACAGGTTCAGCATGG + Intergenic
1091630775 12:2159112-2159134 GTTGAGGGGCAGGTTGGGGAGGG + Intronic
1091702986 12:2676305-2676327 TTGGAGGGACAGGTAGGAGGAGG + Intronic
1093568720 12:20640466-20640488 TTAGAGGGACAGGAGGATGATGG + Intronic
1094186516 12:27648863-27648885 ATGAAGGGAGAGGTGGAGGATGG + Intronic
1099316391 12:81087744-81087766 TGGGAGGGAGAGTTAGAGGAAGG - Intronic
1100111358 12:91245668-91245690 ATGGGGGGACAGGTAGAGGAAGG - Intergenic
1100765947 12:97865820-97865842 CTGGGGGGATAGATTGAGGAGGG - Intergenic
1101255567 12:102973669-102973691 GAGGAGGGAGAGATTGAGGAAGG - Intergenic
1102952391 12:117039565-117039587 TGGGCGGCACAGGTTGGGGAAGG - Intronic
1103403941 12:120661543-120661565 ATGGATGGATAGGTAGAGGATGG - Intronic
1104004355 12:124881668-124881690 TTAGATGGGCTGGTTGAGGAAGG - Intronic
1104109896 12:125695188-125695210 TTGGGAGGACAGGTTGTTGAAGG - Intergenic
1104469466 12:129018075-129018097 ATGGAGGGTCAGCTTGAGGGTGG - Intergenic
1105618570 13:22044927-22044949 TTGGGGGGACAGGATGGGGTTGG + Intergenic
1106397789 13:29397719-29397741 TAGGAGGCACAGGTTGGGAATGG - Intronic
1107722201 13:43260567-43260589 GTGGAGGGGAAGGATGAGGAGGG - Intronic
1108407032 13:50114845-50114867 TTGGAGGGAAATGTTGATGGTGG - Intronic
1108428201 13:50326488-50326510 GTGCAGGGACAGGTTGGGGGTGG + Intronic
1111364029 13:87217382-87217404 TTGCAGGGAGAGGTAGAGTATGG + Intergenic
1112328537 13:98459882-98459904 TGGGAGGGAGAGGCTGAGCAGGG + Intronic
1112438287 13:99407307-99407329 TTGAAGGGACAGTGTAAGGATGG - Intergenic
1112693551 13:101921395-101921417 TTGGAAGAACAGGTTTAAGAAGG - Intronic
1113351917 13:109537847-109537869 TGGGAGGGACAAGGTGTGGACGG + Intergenic
1113718590 13:112533961-112533983 TTGGAGGGAAAGGGTGGGAAGGG - Intronic
1114213869 14:20640761-20640783 TTTGAAGGACATGTTTAGGAAGG - Exonic
1114522041 14:23345955-23345977 TTGGTGGGGCAGGTTGTGGTGGG - Intergenic
1115218643 14:31037194-31037216 TGGGAGGGAGAGGTTGGGGTGGG - Intronic
1115344450 14:32327464-32327486 TTGGAGGCAGTGGTTGAGAATGG + Intergenic
1115429602 14:33300927-33300949 ATTGAGGGCCAGGTAGAGGAAGG + Intronic
1115694554 14:35882364-35882386 TGGGAGGGAGAGGTAGAGGCAGG - Intronic
1116181755 14:41543706-41543728 TTGGAGGGACCGGTTGACAAAGG + Intergenic
1118313678 14:64710825-64710847 TTGGAGGGAGGGGGTGTGGAGGG + Intronic
1119414632 14:74461342-74461364 ATGGAGGGAGATGTTGGGGAAGG - Intergenic
1119645244 14:76343220-76343242 TTGGAGAGACAGATTAAGCAGGG + Intronic
1119784852 14:77305381-77305403 TTTGATGGACAGGTAGGGGATGG - Intronic
1120005692 14:79355268-79355290 TTGGAGGGACAGAGGAAGGAGGG - Intronic
1120274504 14:82354486-82354508 TTGGAGGATGAGCTTGAGGATGG - Intergenic
1120521194 14:85530081-85530103 TAGGAGGGAGAGGAGGAGGAGGG + Intergenic
1120523736 14:85553670-85553692 GTGGAAGGAAAGGGTGAGGACGG + Intronic
1121280577 14:92694547-92694569 TTGGAGGGGCGGGTTGAGGCAGG + Intergenic
1121463198 14:94097806-94097828 TTGGAGGGACAGCTTCCAGAGGG + Intronic
1121616730 14:95318839-95318861 TTGGGTGGATAGGTTGTGGAGGG + Intronic
1121752667 14:96370501-96370523 TTGGGGGGCCAGTTTGAGGTGGG + Intronic
1122233708 14:100320385-100320407 ATGGAGGGACGGATGGAGGAGGG - Intergenic
1122804313 14:104248905-104248927 CTGCAGGCAGAGGTTGAGGAGGG - Intergenic
1122812973 14:104298038-104298060 ATGCAGGGGCAGGTGGAGGAAGG - Intergenic
1122913842 14:104846910-104846932 CTAGAGGGACAGGTTGGGGGAGG + Intergenic
1123029539 14:105445179-105445201 ATGGAGACACAGGTTGAGGTTGG + Intronic
1123476727 15:20596241-20596263 TTGGAGTGAAAGGTTGGGGCTGG + Intergenic
1123641284 15:22404123-22404145 TTGGAGTGAAAGGTTGGGGCTGG - Intergenic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124816636 15:33000532-33000554 TTGGAGAGAGAGGCTGAGGTGGG + Intronic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126824287 15:52533510-52533532 TTGGAGGTACAGGATGAGAGGGG - Intergenic
1127910048 15:63409299-63409321 TTGGATTGACAGGCTGACGAGGG - Intergenic
1129313044 15:74725651-74725673 TTGGAGAGAAAGGTGGCGGAGGG + Intergenic
1129465222 15:75721068-75721090 TTGAAAGGTCAGGTTGAGGAAGG + Intergenic
1129727648 15:77909680-77909702 TGGGAGGGCCAGGGTGGGGAGGG - Intergenic
1129771561 15:78206368-78206390 GGGCAGGGACAGGCTGAGGAAGG - Intronic
1130424972 15:83787839-83787861 CTGGAGGGAGAGGTTGAGAAAGG - Intronic
1130973040 15:88749578-88749600 TAGGAGGGAAAGTGTGAGGAAGG - Intergenic
1132399487 15:101496667-101496689 GTGGAGGGAGAGGGAGAGGACGG - Intronic
1132546481 16:535637-535659 CTGGAGGGGCAGGGTGCGGAGGG - Intronic
1132826360 16:1907541-1907563 CTGGAGGGTCAGGGTGAGGCGGG - Intergenic
1133406357 16:5527637-5527659 TTGGAGGGCAGGGTTTAGGATGG + Intergenic
1133724922 16:8528472-8528494 TTGGTGTGAGAGGTTGAGGAAGG - Intergenic
1133804890 16:9117937-9117959 TTGGAGGGACAGGGAGAGTTGGG - Exonic
1135282020 16:21159965-21159987 TTGGAGGGGAAAGTTGAGGAGGG - Intronic
1135976021 16:27109454-27109476 TTGGAGGGATAGATAGATGATGG + Intergenic
1136120131 16:28127544-28127566 TCCCAGGGACAGGGTGAGGAAGG - Intronic
1137253484 16:46757256-46757278 TTAGGGGGACAGTTTGGGGATGG - Intronic
1137388874 16:48064997-48065019 TTGGAGGCAGAGGCTGTGGAAGG + Intergenic
1137570945 16:49566022-49566044 TTGCAAAGACAGGTTAAGGATGG - Intronic
1137930628 16:52584052-52584074 CTGGAGGCACAGGGTGAGGGAGG - Intergenic
1138318461 16:56090533-56090555 CAGGTGGGACAGGTTGAGGCAGG - Intergenic
1138387339 16:56644621-56644643 CTGGAGGCACAGCTTGAGGCAGG + Intronic
1138441939 16:57040569-57040591 GTGGAAGGCCAGGCTGAGGATGG + Intronic
1139766903 16:69238170-69238192 TTGGAGGGAAAGAAGGAGGAGGG + Intronic
1140783930 16:78321964-78321986 CTGCAGAGACAGGTTGTGGATGG + Intronic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1141168473 16:81676311-81676333 TTGAAGGGACTGGCTGAGGGGGG - Intronic
1141231676 16:82173008-82173030 TTTGAGTGGCAGGTTGAAGAAGG - Intergenic
1142001725 16:87668151-87668173 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
1142317465 16:89357107-89357129 TAGGAGGGACAGTGTAAGGAAGG + Intronic
1142416261 16:89944627-89944649 TTGTGGGGACAGGTGGGGGACGG - Intergenic
1142768952 17:2082782-2082804 TTTGAGGGACAGGGTTAGCATGG + Intronic
1142934417 17:3316076-3316098 CTGGGGGGACAGGTTGTTGATGG - Intergenic
1142966888 17:3587216-3587238 TTGGAGGCCCAGGTTCAGCATGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143458099 17:7080739-7080761 TTGGGGGGAATGGTTGTGGAAGG - Intergenic
1143759729 17:9092359-9092381 TGGGAGGGAGAGGTTGCAGATGG - Intronic
1143965579 17:10754518-10754540 GAGGAGGGACAGCTTGAGAAAGG - Intergenic
1143974757 17:10821619-10821641 TTGGAGGGTAGGGTTGGGGAGGG - Intergenic
1144576336 17:16432043-16432065 ATGGAGGGACAGGAGGACGAGGG + Exonic
1144581201 17:16460509-16460531 TGTGAGGGGCAGGTTGGGGAGGG + Intronic
1144651395 17:17009448-17009470 TTGGTGGGGCTGGTGGAGGATGG - Intergenic
1144673339 17:17145431-17145453 TGGGCGGCACAGGTGGAGGAAGG + Intronic
1144998081 17:19284527-19284549 TTTGGGGGACAGGGTGAGGATGG + Intronic
1146362004 17:32184742-32184764 TTGGAGGCAGAGGTGGAGGCGGG - Intronic
1146862590 17:36317225-36317247 CTGGGGGGACTGGTTGGGGATGG + Intronic
1147092918 17:38121322-38121344 CTGGGGGGACTGGTTGGGGATGG + Intergenic
1147104290 17:38199166-38199188 CTGGGGGGACTGGTTGGGGATGG - Intergenic
1147174740 17:38647848-38647870 CTGTAGGGACAGGTTTGGGATGG + Intergenic
1147363401 17:39945039-39945061 GTGGGGGGGCAGGTTGAGGAGGG + Intergenic
1147391420 17:40111660-40111682 TTAGAGAGAAAGGTTGAGGCTGG + Intergenic
1147403033 17:40192333-40192355 TTGAAAGGAAAGCTTGAGGAAGG - Intronic
1147553010 17:41458169-41458191 TTGGAGGGTGAGGTTCAGAAAGG + Intergenic
1148425203 17:47589251-47589273 CTGGGGGGACTGGTTGGGGATGG + Intronic
1150326332 17:64261678-64261700 TTGGAGGGAGAGGATGTGGAGGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1152375296 17:79915724-79915746 GTCGAGGGGCAGGTGGAGGAGGG + Intergenic
1152656358 17:81521139-81521161 TGGGAGGGAGAGGTTGCGGTGGG - Intronic
1156503233 18:37572946-37572968 AGGGAGGGAGAGGCTGAGGATGG + Intergenic
1156504157 18:37578249-37578271 TAGGATGGACAGGGAGAGGAGGG + Intergenic
1157076180 18:44470285-44470307 TAGGAAGGACAGGATGAAGAGGG + Intergenic
1158016311 18:52788731-52788753 TTGGAGGAACAGGGCCAGGAAGG + Intronic
1159375625 18:67588855-67588877 TTGGTGGGAAAGTTTGACGATGG - Intergenic
1160386534 18:78500346-78500368 TTGGAGGGACGGGGTCTGGAGGG + Intergenic
1160389904 18:78522083-78522105 CTGGATGGGGAGGTTGAGGATGG - Intergenic
1160819840 19:1052686-1052708 TAGGAGGGAGAGGAGGAGGAGGG + Intronic
1161214638 19:3087862-3087884 TGGCAGAGACTGGTTGAGGAGGG + Intergenic
1161243157 19:3234158-3234180 ATGGAGGCCCAGGTAGAGGAGGG + Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161470816 19:4456102-4456124 TTGGAGGGGAAGGTTGGGAAAGG - Intronic
1162043589 19:7984819-7984841 TTGGAGGCAAAGGTGGAGGTGGG - Intronic
1162161764 19:8723314-8723336 TTTGAAGGTCAGGTAGAGGAGGG - Intergenic
1162174749 19:8822789-8822811 TGGGAAGGATGGGTTGAGGAGGG - Intronic
1162322970 19:9980747-9980769 TTGGAGGGACTGGCTGAGCCTGG + Intronic
1163149042 19:15400339-15400361 TAGGACGGAGAGGATGAGGAGGG - Exonic
1163421180 19:17214554-17214576 CTGGAGTGACAGGATGAGGGTGG - Intergenic
1164435841 19:28228594-28228616 CTGGAGGGAGAGGCTGTGGATGG - Intergenic
1164558861 19:29274755-29274777 GTGGAGGGACAGGAGGTGGAAGG + Intergenic
1165855999 19:38879580-38879602 TGGAAGGGACAGGGTGAGGTGGG - Intronic
1165906609 19:39198124-39198146 TTGGAGGGCCAGGTTGCTGAGGG + Intronic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233916 19:48302493-48302515 TTGGAGGGACAGATGATGGATGG + Intronic
1168241769 19:55092341-55092363 GAGGAGGGTCAGGTGGAGGATGG + Intronic
1168411300 19:56141669-56141691 GGGGAGGGACAGGTGGGGGAGGG + Intronic
1168450719 19:56464418-56464440 TGGGAGGCAGAGGTTGAGGTGGG + Intronic
1168721618 19:58557753-58557775 TTGGGGTGACAGGTGGAGGAGGG - Intronic
925033909 2:671959-671981 GTGGAGGGAAAGGCTGAGCAGGG + Intronic
925041542 2:735110-735132 TTGGAGCTCCAGGTTGTGGATGG - Intergenic
925093315 2:1172824-1172846 GTGGAGGGACAGCATCAGGAAGG - Intronic
925216437 2:2099989-2100011 GAGGATGGACAGGGTGAGGATGG - Intronic
925244543 2:2369360-2369382 TTGGTGGGACACGTTGATAATGG - Intergenic
926099236 2:10103467-10103489 GTGGAGGGACAGGTTGGCGTGGG - Intergenic
926607764 2:14914572-14914594 TTGCAGGAACAGATTGGGGAGGG + Intergenic
927348462 2:22076336-22076358 TGGGAGGGACAGGGAGAGGATGG - Intergenic
928157189 2:28887633-28887655 ATGGAGGGACAGGGTCAGGGAGG - Intergenic
928363875 2:30686981-30687003 TTAGAGGGAAAGGATGAGGAGGG + Intergenic
929578220 2:43066033-43066055 CTGGCGGGAGAGGTTGAGGAAGG + Intergenic
932282951 2:70510400-70510422 TTGGAGAGCCAGGGTGGGGAGGG - Intronic
932445687 2:71779670-71779692 TTGCAGGGACAGACTGAGGTGGG - Intergenic
932467879 2:71935061-71935083 GAGGAGGGGCAGGTTGGGGATGG + Intergenic
933462886 2:82612065-82612087 TTAGAGGGACAGATTGATGGCGG + Intergenic
934554622 2:95280887-95280909 GTGGGAGGACAGGTTGAGGTGGG - Intronic
934683847 2:96306067-96306089 TTGGGGGCACAGGTTTAGGTGGG - Intergenic
934947981 2:98555748-98555770 GTGGAGGGGCATGGTGAGGAGGG - Exonic
936395083 2:112120546-112120568 TCTGAGGGACATGTGGAGGAGGG - Intergenic
936501288 2:113068529-113068551 TTGGATGGAAAGATTGAGTAAGG - Intronic
937408737 2:121654200-121654222 ATGGAGGAGCAGGTTGGGGATGG + Intergenic
937416904 2:121722239-121722261 TTGGAAGCACAGTTTGAGGTTGG + Intergenic
937681994 2:124654077-124654099 GTGAAGGGACAGGATGAGGCAGG + Intronic
937879207 2:126852406-126852428 TTGGTGAGAGAGGTTGAGGGTGG - Intergenic
938724754 2:134097432-134097454 TTGGAGGGACAGGAGGATGGAGG - Intergenic
940982082 2:160014898-160014920 TTGGAAGGACAGGGAGAGGGAGG + Intronic
942804197 2:179910568-179910590 TTGCAGGGAAAAGTTGAGCAAGG + Intergenic
942942205 2:181631629-181631651 TTGAAGGGAGGGCTTGAGGAAGG + Intronic
944373931 2:199017915-199017937 TTGGAAGGTCAGAGTGAGGAAGG + Intergenic
945261959 2:207851904-207851926 TTGGCGGGTCAGGTTCAGCAAGG - Intronic
945278364 2:208011603-208011625 TTAGGGGGACAGGGTGGGGAGGG + Intronic
946182192 2:217955444-217955466 TTGGAGGGACTGGTGGTGGACGG - Intronic
946182209 2:217955521-217955543 TTGGAGGGACTGGTGGTGGACGG - Intronic
946528629 2:220547446-220547468 ATGGAGGGAAAGGGAGAGGAAGG - Intergenic
947153827 2:227140679-227140701 TAGGAAGGACAGTTTGATGAGGG - Intronic
947591595 2:231388964-231388986 GTGGTGGGACAGGTGGAGGAGGG + Intergenic
947593690 2:231398351-231398373 CTTGAGGGTCAGGTTGAAGAAGG - Exonic
948675006 2:239591980-239592002 CTTGAGGGCCTGGTTGAGGAAGG + Intergenic
948882234 2:240865470-240865492 TTGGAGTAGCAGGTTGTGGACGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169177188 20:3527766-3527788 TTGCAGGGACATGATGAGGCTGG + Intronic
1169868857 20:10230248-10230270 TGGGAGGGACAAGTAAAGGAAGG + Intronic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1172355395 20:34276392-34276414 CACGAGAGACAGGTTGAGGAGGG + Intergenic
1172461986 20:35126120-35126142 TTGGAGGGACAGGTTGAGGATGG - Intronic
1173010723 20:39179229-39179251 TTGCAGGCAGAGGTTGATGATGG + Intergenic
1173125940 20:40336186-40336208 TGGGAGGGTCAGGTTGAGTAAGG - Intergenic
1173563566 20:44023124-44023146 TAGGAGGGAAAGATAGAGGAAGG + Intronic
1173605330 20:44327211-44327233 TGGGAGGGCAAGGATGAGGAGGG + Intergenic
1174163122 20:48565606-48565628 TTGGAGGGACGAAATGAGGAAGG - Intergenic
1175222862 20:57427231-57427253 TTAGAGGGAGAGGTTGGGGCTGG - Intergenic
1175437202 20:58961845-58961867 ATGGAGTGACTGGTTCAGGATGG - Intergenic
1175533558 20:59691113-59691135 TTGGAGGAACTAGTTGAGGCTGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1177653394 21:23986062-23986084 TTTGGGGGAGAGGTTGAGGTAGG + Intergenic
1178329964 21:31680110-31680132 TCTGAGGGACATCTTGAGGAAGG - Intronic
1178757050 21:35361456-35361478 TTTGAGTGAAAGGTGGAGGAAGG - Intronic
1179162449 21:38909515-38909537 TTTCTGGGACAAGTTGAGGAAGG + Intergenic
1181162261 22:20965789-20965811 TGGGAGGGTCAGGTGGAGCAGGG + Intronic
1182900180 22:33891479-33891501 TAGGAGAGACAGGTGCAGGAAGG + Intronic
1184018015 22:41800471-41800493 CAGGAGGGACAGGACGAGGATGG + Intergenic
1184797857 22:46742192-46742214 CTAGATGGGCAGGTTGAGGATGG - Intergenic
949929556 3:9068021-9068043 GTGGAGGGACATGTCGAGAAGGG - Intronic
950429074 3:12940645-12940667 TTGCAGGGGCAGGCTGGGGAGGG - Intronic
950678354 3:14568223-14568245 GGGGAGGGACAGACTGAGGAGGG + Intergenic
950873525 3:16249660-16249682 GTGCAGGGACAGGCTGGGGAGGG + Intergenic
951253951 3:20427437-20427459 TTGCAGGGACAGGATGAAGCTGG - Intergenic
951553994 3:23902602-23902624 TTGGAGAGGCAGGTGGAGGTGGG - Intronic
951995273 3:28720789-28720811 GTGGAGGGATGGGGTGAGGAAGG + Intergenic
952268355 3:31808227-31808249 TTGGAGGGAAAGGGGGAGAAAGG + Intronic
952380408 3:32800127-32800149 TTGGATGGAGAGGTTAAGGAAGG - Intergenic
952416637 3:33096400-33096422 TTGGGGGTCCAGGTTGAGGGGGG - Intronic
953787093 3:45919551-45919573 GTGGAGTGACATGTTCAGGAAGG + Exonic
954424448 3:50435987-50436009 TTAGAGACACAGGGTGAGGAGGG + Intronic
955022266 3:55132832-55132854 TTGGAGGGACAGGGTGTTGAGGG - Intergenic
956680197 3:71772056-71772078 CTTGAGTGACAGGTTTAGGAAGG + Intronic
957041085 3:75336054-75336076 TTGGAGGGAACGGTTAAGGGAGG + Intergenic
958255599 3:91321304-91321326 CTGTAGGAACATGTTGAGGAGGG - Intergenic
959222675 3:103541599-103541621 TTTGTGGGACAGGTGGAGGTGGG + Intergenic
960443959 3:117724490-117724512 TTGGAGGAAGAGGTTATGGATGG + Intergenic
960744364 3:120870294-120870316 GTGGATGGAGAGGTTGAGGAAGG - Intergenic
961045891 3:123707709-123707731 TTGGAGGGAAGGGTTAAGGGAGG + Intronic
961314285 3:126023920-126023942 TTGTAGTGGCAGCTTGAGGATGG - Intronic
961388971 3:126541163-126541185 TAGGAGGGACAGGCTCAGAAGGG + Intronic
961796835 3:129415214-129415236 GTGGAGGCACAGGATGGGGAGGG + Intronic
963018570 3:140849529-140849551 TTGGAGGAGAAGGTAGAGGAAGG - Intergenic
963073054 3:141320754-141320776 TTAGAGGGACAGGAAGAGAAGGG + Intergenic
964703295 3:159592454-159592476 TTGTAAGGACAGGATGGGGAAGG - Intronic
964773660 3:160252479-160252501 AAGGAGGGACAGCTTGAGGCAGG + Intronic
965296173 3:166949598-166949620 TTGGAGGAAAAGGTGGAGGGTGG - Intergenic
965516238 3:169624468-169624490 ATGGAAAGACAAGTTGAGGATGG + Intronic
965517676 3:169639014-169639036 TTGGAGTGCCACGTTGAAGATGG + Intronic
966807557 3:183818866-183818888 CTGGAGGGAGAGGATGAGGCTGG + Intronic
968598367 4:1496901-1496923 ATGGATGGATAGGTAGAGGATGG + Intergenic
968817963 4:2831548-2831570 CTGGAGGGGCAGGGAGAGGAAGG - Intronic
969146027 4:5124857-5124879 TTGGAGGGGAAGGTTCATGACGG - Intronic
969514876 4:7641674-7641696 TTGGATGGACAGATCGAGGTTGG + Intronic
969522944 4:7689341-7689363 TTGGAGGAACGGATGGAGGATGG - Intronic
970092092 4:12421253-12421275 ATGGAGGGACAAGTTGAAGCAGG - Intergenic
970692031 4:18630937-18630959 GTGGAGGGACAGGTGCAGGCAGG - Intergenic
970789771 4:19843294-19843316 TTAGAGGGAGTGGTTGGGGATGG + Intergenic
970870514 4:20811886-20811908 TTGGATGGGCAGGTTGGGGCTGG + Intronic
971373387 4:26036226-26036248 GAGGAGGGAGAGGTTGGGGAAGG + Intergenic
973886215 4:55324743-55324765 TTCAAGGGAGAAGTTGAGGATGG + Intergenic
974355127 4:60802650-60802672 TTAGAAAGACAGGTTGAGGGAGG - Intergenic
974890437 4:67875554-67875576 TTGTAGGGACGGGTTGCGGATGG - Intronic
977180160 4:93864426-93864448 TTAGAGGGATAGATTGAGGCAGG + Intergenic
977280875 4:95038224-95038246 TTTGAGGAACAGGATGAAGAAGG + Intronic
977589927 4:98814747-98814769 TTGGAGGAACAGGTCCAGGAAGG - Intergenic
978398830 4:108310331-108310353 TCAGAGGGACAGCTTGACGATGG + Intergenic
978800474 4:112751174-112751196 TTGGAGGGGGAGGTTGGGGTTGG - Intergenic
981800645 4:148651791-148651813 TTTGATGGAGAGGTTTAGGAAGG + Intergenic
981841159 4:149113940-149113962 TTGGAGGCAGAGCTGGAGGATGG + Intergenic
982146244 4:152396376-152396398 TTGTAGGGAGGGGTTGGGGAAGG - Intronic
984631912 4:182070135-182070157 GTGGAGGCACAGGTGGGGGAAGG + Intergenic
985025829 4:185738076-185738098 GTGGAGGCAGATGTTGAGGAAGG - Intronic
985478143 5:91396-91418 TTGAGGGGACAGGTTGAGGTGGG + Intergenic
986346894 5:6844080-6844102 ATGGAGCAAGAGGTTGAGGAAGG + Intergenic
987109529 5:14672348-14672370 TGGGAGGGCCAGACTGAGGAAGG - Intronic
988317139 5:29644752-29644774 TGGGAGGGACATGTTGTGGGAGG + Intergenic
988905247 5:35781365-35781387 TTGGAGGGAGAAATTGAAGAGGG + Intronic
991725824 5:69535014-69535036 TTGGAAGACCAGGATGAGGAGGG + Intronic
991869130 5:71092841-71092863 TTGGAAGACCAGGATGAGGAGGG - Intergenic
992028019 5:72690551-72690573 TAAGAGGGACATGTTGAGGAAGG - Intergenic
992242035 5:74781749-74781771 TTGGAAGACCAGGGTGAGGAGGG - Exonic
992381850 5:76245284-76245306 TTGGAGGAAGAGGAAGAGGAAGG + Intronic
992828468 5:80571278-80571300 TTGGAGGGTCTGGTGGAGAAAGG + Intergenic
993091379 5:83430675-83430697 TAGGAGTGTCAGGTGGAGGAAGG - Intergenic
994438407 5:99768517-99768539 TCAGAGTGACAGGCTGAGGAGGG - Intergenic
996952639 5:129146487-129146509 TTGGAGGGACAGGTTACAAAGGG - Intergenic
998131797 5:139655192-139655214 ATGGAGGGACAGGCTGAGGGTGG - Intronic
999252030 5:150188463-150188485 TGGGAGGGAGTGGTTGAGCAAGG + Intergenic
999743307 5:154573419-154573441 TTGGAGTGAGATGTGGAGGAGGG + Intergenic
999865730 5:155698544-155698566 TTGGATGGTCAGGTTTAGAAAGG + Intergenic
1000044268 5:157508780-157508802 TTGGAGGGAGACATTGAGGAGGG - Intronic
1000344087 5:160300049-160300071 TTGGGGGGACACGAGGAGGAAGG - Intronic
1001172112 5:169429311-169429333 TCGGAGGGAAAGGTGGAGGCTGG - Intergenic
1001303946 5:170557750-170557772 GTGGAGGGACAGGGAGAAGATGG + Intronic
1001474145 5:172037604-172037626 TTGGAGGGACAGGGGCTGGAGGG - Intergenic
1002394811 5:178944343-178944365 TTTGAGGAAAAGGTTAAGGAAGG - Intronic
1002418258 5:179132082-179132104 GCAGAGGGACAGGTTGGGGAGGG + Intronic
1003297890 6:4849925-4849947 TTGGGGGGAAAGGGTGGGGAGGG + Intronic
1003479891 6:6521176-6521198 GGGGAGGGAGAGGCTGAGGAGGG - Intergenic
1004243851 6:13953441-13953463 TAGGAGAGACTGGGTGAGGATGG + Intronic
1004347295 6:14860494-14860516 TTGGAGGGACAAGGTTAGGTGGG - Intergenic
1004899928 6:20184341-20184363 GAGGGGGGACAGGTGGAGGACGG + Intronic
1005140167 6:22622755-22622777 TTGGAGGGAAAGGAAGAGGAAGG + Intergenic
1006466968 6:34201480-34201502 GTGGAGGGAGAGGTAAAGGAAGG + Intergenic
1007853467 6:44829129-44829151 TTGGAGGAACAGGAAAAGGAGGG + Exonic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1009188232 6:60599284-60599306 CTGTAGGAACAGGATGAGGAGGG + Intergenic
1011320667 6:86088993-86089015 TTGGGGGAACAGGTTGTGTATGG + Intergenic
1011761967 6:90576873-90576895 CTGGAGGGACAGGCAGAGGTTGG + Intronic
1011762906 6:90587180-90587202 AAGGAGGGACAGGTTGGGGGTGG + Intergenic
1012021976 6:93934201-93934223 CTGGAGGGACAATTTGAAGATGG + Intergenic
1012839440 6:104310762-104310784 TTGGGGCGACAGGTTGAGAGAGG - Intergenic
1013241730 6:108252711-108252733 TTGGAGGCAGAGGTTGCGGTGGG - Intronic
1013438951 6:110141621-110141643 TTGGAGATACAAGTTGAGTAAGG - Intronic
1018236868 6:161735101-161735123 TTGTAGAGAGAGGCTGAGGAGGG + Intronic
1018844676 6:167547378-167547400 GAGGAGGGACTGATTGAGGAGGG - Intergenic
1019480760 7:1265657-1265679 TTGGAGAGACAGATTGTGTATGG + Intergenic
1019480766 7:1265680-1265702 TTGGGGGGACAGATTGTGTATGG + Intergenic
1020357440 7:7292806-7292828 TAGGAGGGACGGGTTGGGAAGGG - Intergenic
1020404311 7:7814779-7814801 TGGGAGAGACAGGTTAAGGAAGG - Intronic
1021056451 7:16053297-16053319 GTGGAGGGGCGGGATGAGGATGG - Intergenic
1022351968 7:29574730-29574752 TTACAGGGAGAGGTTGAGGCAGG + Intergenic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1023344137 7:39253673-39253695 GTGGAGGGTCGGGTAGAGGAGGG + Intronic
1024334746 7:48195906-48195928 GTAGAGGGATAGGATGAGGAGGG + Intronic
1024334962 7:48197471-48197493 GTAGAGGGATAGGATGAGGAGGG + Intronic
1024624957 7:51199070-51199092 TTGGGGGGATAGGTTGGGTATGG - Intronic
1024996142 7:55274387-55274409 TGGGAGGGACTGCTTGAGGAAGG - Intergenic
1025956746 7:66189034-66189056 CTAGATGGACAGGTAGAGGATGG - Intergenic
1026494106 7:70887993-70888015 GTGGAGGGACAGATTGGGAAAGG + Intergenic
1027936322 7:84608199-84608221 TTGGATGGAGAGGTGGGGGAAGG - Intergenic
1028472922 7:91224189-91224211 GCGGAGGGACAGGCAGAGGAGGG - Intergenic
1029389997 7:100268684-100268706 GCGGAGGGAAAGGTTCAGGAAGG + Intronic
1029400476 7:100342292-100342314 TGGGAGGGGCAGGTGGGGGAGGG - Intronic
1029669755 7:102021411-102021433 TTGGAGGCTGAGGTGGAGGATGG - Intronic
1031816947 7:126449847-126449869 TTGGAGTGACAGGGCCAGGAGGG - Intronic
1031886107 7:127247585-127247607 TTGGTGGGGCAGAGTGAGGATGG + Intronic
1032369123 7:131328280-131328302 TTGGGGGTTGAGGTTGAGGAGGG + Intronic
1032704904 7:134413317-134413339 TTGAACGGAAAGGTGGAGGAGGG - Intergenic
1033029898 7:137815942-137815964 ATTTAGGGACAGGTTGATGATGG - Intronic
1033879712 7:145865406-145865428 TTGGGGGGAAAGGGTGATGAAGG + Intergenic
1034401578 7:150864951-150864973 GTAGAGGGGCAGGTTGTGGAGGG - Intergenic
1036784004 8:11673337-11673359 TTGTAGGCACATGTGGAGGAGGG + Intergenic
1037184035 8:16040107-16040129 GTGGAGGGAAATGTTGAGGTGGG - Intergenic
1038914380 8:32004216-32004238 ATTCAGGGACTGGTTGAGGATGG + Intronic
1039644325 8:39264058-39264080 TGGGAGGGAAAGGCTAAGGAAGG - Intronic
1039722947 8:40184527-40184549 TTGGAGGGACACGTTCACCATGG - Intergenic
1039862228 8:41468866-41468888 CTGGAGAGACAGGGTGAGGCTGG - Intergenic
1040107998 8:43550863-43550885 TTTCAGGGAAAGGTTGAGGCAGG - Intergenic
1040111992 8:43570735-43570757 TTTCAGGGGGAGGTTGAGGAAGG - Intergenic
1041436526 8:57848044-57848066 TTTGAGGGACAGGTTTTGAATGG + Intergenic
1042039589 8:64577961-64577983 TTGGATGGCCAGGGAGAGGAGGG + Intergenic
1042083024 8:65076860-65076882 GTGGAGGGACAGGGAGGGGAGGG - Intergenic
1042850582 8:73212253-73212275 TTGGGTAGACAGGATGAGGAAGG - Intergenic
1043604542 8:81984354-81984376 TTGGAGGGATAGATTAAAGATGG - Intergenic
1044748787 8:95396684-95396706 GAGGAGGGAAAGGTTGAGAATGG + Intergenic
1045891594 8:107164398-107164420 ATGGAGGGACAGGTGGCAGAGGG - Intergenic
1047701867 8:127456897-127456919 TAGGAGGGCCAGGGTAAGGAGGG - Intergenic
1048450646 8:134530585-134530607 TTCAAGGGACATGTTGAAGAAGG - Intronic
1048765827 8:137843416-137843438 CTGGAGGCAGAGGTCGAGGAGGG - Intergenic
1048888859 8:138930780-138930802 TGGGAGAGACAGGTTGGGGCTGG + Intergenic
1049856355 8:144864414-144864436 TTGGATGGACAGGTTAAGGGAGG + Intergenic
1050219633 9:3372657-3372679 CTGGAGGCAGAGGTTGAGGCAGG - Intronic
1050243847 9:3667171-3667193 TTGGAGGGGAAGGTTGGGAAAGG + Intergenic
1052384788 9:27809577-27809599 TTGGAGGGACAGGTTAAGGGAGG + Intergenic
1052708355 9:32021021-32021043 TTGGAGTGACACTTTGAAGATGG + Intergenic
1052812721 9:33075820-33075842 TGGCAAGGACAGGTGGAGGATGG + Intronic
1053415812 9:37946194-37946216 TTGGTGGGGAAGGTAGAGGACGG - Intronic
1054452978 9:65413184-65413206 TGGGAGGGAGAGGTTGAGCGTGG - Intergenic
1054798769 9:69325999-69326021 TTGGAAGGACAGGGTGTGGGTGG + Intronic
1054874308 9:70079175-70079197 GTGGAGGGTCAGGTAGAGCATGG - Intronic
1055156798 9:73072689-73072711 TTGGGGGGACAGGTTGTGTTTGG - Intronic
1055781281 9:79824104-79824126 TTGGAGGGAGTGGTTGAGGCAGG + Intergenic
1056853103 9:90101089-90101111 TTAGAGTGACAGTTTGAAGATGG + Intergenic
1058637399 9:107049779-107049801 TTGGATCCACAGGCTGAGGAGGG + Intergenic
1058998955 9:110328351-110328373 TTGGGGGGATGGGATGAGGAAGG + Intronic
1059940362 9:119353290-119353312 AAGGAGGGAAAGGTGGAGGAAGG - Intronic
1060294125 9:122331665-122331687 GAGGAGGGACAGGTTGGGGGAGG + Intergenic
1061483600 9:130909156-130909178 GTGGAGGGAGAGGGTGAGAAGGG - Intronic
1062017841 9:134300546-134300568 TGGGAGGGACAGGTTGTGCGTGG - Intergenic
1062057909 9:134478164-134478186 TTGGACAGACGGGGTGAGGATGG - Intergenic
1062590252 9:137271357-137271379 GTGTGCGGACAGGTTGAGGATGG - Intronic
1062724680 9:138065199-138065221 TGGGAGGGACTGGATGAGGATGG - Intronic
1203792387 EBV:158872-158894 TTGGAGGTGCAGGTAGAGAAGGG + Intergenic
1186083855 X:5964686-5964708 TTGTAGAGACAGGGTGGGGAGGG + Intronic
1186107905 X:6226667-6226689 GTTGAGGGACAGGAGGAGGAAGG + Intronic
1186246614 X:7622471-7622493 ATGGAGGGAGAGGAAGAGGAAGG - Intergenic
1186246914 X:7624740-7624762 TTTGGGGCATAGGTTGAGGAGGG - Intergenic
1186585133 X:10865329-10865351 TGGGAAGGAAAGGGTGAGGATGG + Intergenic
1186633898 X:11381052-11381074 TTGTAGGGACAGGTTAAGTGAGG + Intronic
1187061194 X:15789074-15789096 TGGGAGGGCTAGGTTAAGGAGGG - Intergenic
1187288042 X:17925105-17925127 TTGGTAGGACGGGTAGAGGATGG - Intergenic
1187429773 X:19211389-19211411 TTGGAGCGCCAGGTGGGGGAAGG + Intergenic
1189136876 X:38559675-38559697 AAGAAGGGACAGGTTGAGCAAGG - Intronic
1189740177 X:44109609-44109631 TTGCAGGGCCAGGGTGGGGAGGG + Intergenic
1191254305 X:58273220-58273242 TTTCAGGGAAAGGTTGAGGCAGG - Intergenic
1192174876 X:68879331-68879353 GGGCAGGGACAGGGTGAGGAGGG - Intergenic
1195945270 X:110203576-110203598 GTGGAGGGTCAGGTTGTGCAAGG + Intronic
1196035539 X:111139829-111139851 TTGGAGGTACAGATTAAGGTAGG + Intronic
1196551543 X:117032601-117032623 CTGGAGGGACAGTGTGAGAAAGG - Intergenic
1197446065 X:126552969-126552991 TGGGAGGGACAGGGAGGGGAGGG + Intergenic
1197753886 X:129982167-129982189 TCGAAGGGGGAGGTTGAGGAAGG - Intronic
1197970496 X:132110241-132110263 TTTAAGGGATAGGTGGAGGAGGG + Intronic
1198038110 X:132821565-132821587 TTGGAGGGCCTGGGTGGGGAGGG - Intronic
1198607483 X:138357442-138357464 TTGGAGGTATAGGTAAAGGAGGG - Intergenic
1198936997 X:141908890-141908912 GTGGAGGGCCTGGTTGAGGCTGG + Exonic
1199074478 X:143512865-143512887 TTGGATGGACAGGTTAAGGAAGG - Intronic
1199093489 X:143716158-143716180 TTGAATGGACAGGTTAAGAAAGG - Intronic
1199480326 X:148291454-148291476 TTGGAGAGGCAGGTGTAGGAAGG - Intergenic
1199764704 X:150932663-150932685 TTGGAGGGAGAGACTGAGCATGG - Intergenic
1199808012 X:151320820-151320842 TTGGAGGCAGAGGTTGGGGTGGG - Intergenic
1199907713 X:152251341-152251363 TAGAAGGTGCAGGTTGAGGAGGG - Intronic
1201252742 Y:12075550-12075572 TGGGAGGTACAGGTTGCAGAGGG + Intergenic
1202039619 Y:20668312-20668334 GTGGATGGACAGGTTAAGGGAGG - Intergenic