ID: 1172467378

View in Genome Browser
Species Human (GRCh38)
Location 20:35166315-35166337
Sequence GGCACTTCCCCCTTAGGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172467378_1172467385 14 Left 1172467378 20:35166315-35166337 CCTCATCCTAAGGGGGAAGTGCC No data
Right 1172467385 20:35166352-35166374 ACTCCTTTGTTACCCAAATTGGG No data
1172467378_1172467384 13 Left 1172467378 20:35166315-35166337 CCTCATCCTAAGGGGGAAGTGCC No data
Right 1172467384 20:35166351-35166373 CACTCCTTTGTTACCCAAATTGG No data
1172467378_1172467387 19 Left 1172467378 20:35166315-35166337 CCTCATCCTAAGGGGGAAGTGCC No data
Right 1172467387 20:35166357-35166379 TTTGTTACCCAAATTGGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172467378 Original CRISPR GGCACTTCCCCCTTAGGATG AGG (reversed) Intergenic