ID: 1172467379

View in Genome Browser
Species Human (GRCh38)
Location 20:35166321-35166343
Sequence TTCAAAGGCACTTCCCCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172467379_1172467384 7 Left 1172467379 20:35166321-35166343 CCTAAGGGGGAAGTGCCTTTGAA No data
Right 1172467384 20:35166351-35166373 CACTCCTTTGTTACCCAAATTGG No data
1172467379_1172467387 13 Left 1172467379 20:35166321-35166343 CCTAAGGGGGAAGTGCCTTTGAA No data
Right 1172467387 20:35166357-35166379 TTTGTTACCCAAATTGGGCCAGG No data
1172467379_1172467385 8 Left 1172467379 20:35166321-35166343 CCTAAGGGGGAAGTGCCTTTGAA No data
Right 1172467385 20:35166352-35166374 ACTCCTTTGTTACCCAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172467379 Original CRISPR TTCAAAGGCACTTCCCCCTT AGG (reversed) Intergenic
No off target data available for this crispr