ID: 1172467382

View in Genome Browser
Species Human (GRCh38)
Location 20:35166336-35166358
Sequence AAGGAGTGTGGACCCTTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172467382_1172467387 -2 Left 1172467382 20:35166336-35166358 CCTTTGAAGGGTCCACACTCCTT No data
Right 1172467387 20:35166357-35166379 TTTGTTACCCAAATTGGGCCAGG No data
1172467382_1172467385 -7 Left 1172467382 20:35166336-35166358 CCTTTGAAGGGTCCACACTCCTT No data
Right 1172467385 20:35166352-35166374 ACTCCTTTGTTACCCAAATTGGG No data
1172467382_1172467384 -8 Left 1172467382 20:35166336-35166358 CCTTTGAAGGGTCCACACTCCTT No data
Right 1172467384 20:35166351-35166373 CACTCCTTTGTTACCCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172467382 Original CRISPR AAGGAGTGTGGACCCTTCAA AGG (reversed) Intergenic
No off target data available for this crispr