ID: 1172467384

View in Genome Browser
Species Human (GRCh38)
Location 20:35166351-35166373
Sequence CACTCCTTTGTTACCCAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172467378_1172467384 13 Left 1172467378 20:35166315-35166337 CCTCATCCTAAGGGGGAAGTGCC No data
Right 1172467384 20:35166351-35166373 CACTCCTTTGTTACCCAAATTGG No data
1172467382_1172467384 -8 Left 1172467382 20:35166336-35166358 CCTTTGAAGGGTCCACACTCCTT No data
Right 1172467384 20:35166351-35166373 CACTCCTTTGTTACCCAAATTGG No data
1172467379_1172467384 7 Left 1172467379 20:35166321-35166343 CCTAAGGGGGAAGTGCCTTTGAA No data
Right 1172467384 20:35166351-35166373 CACTCCTTTGTTACCCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172467384 Original CRISPR CACTCCTTTGTTACCCAAAT TGG Intergenic
No off target data available for this crispr