ID: 1172467389

View in Genome Browser
Species Human (GRCh38)
Location 20:35166365-35166387
Sequence TTAAGCAACCTGGCCCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172467389_1172467396 12 Left 1172467389 20:35166365-35166387 CCAAATTGGGCCAGGTTGCTTAA No data
Right 1172467396 20:35166400-35166422 CAGTAGCTAACAACAGGGGTGGG No data
1172467389_1172467397 21 Left 1172467389 20:35166365-35166387 CCAAATTGGGCCAGGTTGCTTAA No data
Right 1172467397 20:35166409-35166431 ACAACAGGGGTGGGAGAGCCTGG No data
1172467389_1172467395 11 Left 1172467389 20:35166365-35166387 CCAAATTGGGCCAGGTTGCTTAA No data
Right 1172467395 20:35166399-35166421 TCAGTAGCTAACAACAGGGGTGG No data
1172467389_1172467393 7 Left 1172467389 20:35166365-35166387 CCAAATTGGGCCAGGTTGCTTAA No data
Right 1172467393 20:35166395-35166417 TTCTTCAGTAGCTAACAACAGGG No data
1172467389_1172467394 8 Left 1172467389 20:35166365-35166387 CCAAATTGGGCCAGGTTGCTTAA No data
Right 1172467394 20:35166396-35166418 TCTTCAGTAGCTAACAACAGGGG No data
1172467389_1172467392 6 Left 1172467389 20:35166365-35166387 CCAAATTGGGCCAGGTTGCTTAA No data
Right 1172467392 20:35166394-35166416 GTTCTTCAGTAGCTAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172467389 Original CRISPR TTAAGCAACCTGGCCCAATT TGG (reversed) Intergenic
No off target data available for this crispr