ID: 1172473282

View in Genome Browser
Species Human (GRCh38)
Location 20:35217101-35217123
Sequence ATGTATATGAGTGAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172473282_1172473287 -5 Left 1172473282 20:35217101-35217123 CCAACCTCCTCACTCATATACAT No data
Right 1172473287 20:35217119-35217141 TACATGCTTACTCAAGGGCATGG No data
1172473282_1172473286 -10 Left 1172473282 20:35217101-35217123 CCAACCTCCTCACTCATATACAT No data
Right 1172473286 20:35217114-35217136 TCATATACATGCTTACTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172473282 Original CRISPR ATGTATATGAGTGAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr