ID: 1172474289

View in Genome Browser
Species Human (GRCh38)
Location 20:35226169-35226191
Sequence TTCCCCCACCACCCCGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172474279_1172474289 14 Left 1172474279 20:35226132-35226154 CCCCCTCTTAAACGCTCCTCAGG No data
Right 1172474289 20:35226169-35226191 TTCCCCCACCACCCCGGCCCAGG No data
1172474284_1172474289 -2 Left 1172474284 20:35226148-35226170 CCTCAGGTCTTCTCTACCCCTTT No data
Right 1172474289 20:35226169-35226191 TTCCCCCACCACCCCGGCCCAGG No data
1172474282_1172474289 12 Left 1172474282 20:35226134-35226156 CCCTCTTAAACGCTCCTCAGGTC No data
Right 1172474289 20:35226169-35226191 TTCCCCCACCACCCCGGCCCAGG No data
1172474281_1172474289 13 Left 1172474281 20:35226133-35226155 CCCCTCTTAAACGCTCCTCAGGT No data
Right 1172474289 20:35226169-35226191 TTCCCCCACCACCCCGGCCCAGG No data
1172474283_1172474289 11 Left 1172474283 20:35226135-35226157 CCTCTTAAACGCTCCTCAGGTCT No data
Right 1172474289 20:35226169-35226191 TTCCCCCACCACCCCGGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172474289 Original CRISPR TTCCCCCACCACCCCGGCCC AGG Intergenic
No off target data available for this crispr