ID: 1172474522

View in Genome Browser
Species Human (GRCh38)
Location 20:35226873-35226895
Sequence CCTCCCGGGCGCCGCGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172474513_1172474522 19 Left 1172474513 20:35226831-35226853 CCCTGGGCGGCTGCTGCTGCTGC 0: 1
1: 1
2: 24
3: 143
4: 933
Right 1172474522 20:35226873-35226895 CCTCCCGGGCGCCGCGCGGGCGG 0: 1
1: 0
2: 1
3: 30
4: 231
1172474514_1172474522 18 Left 1172474514 20:35226832-35226854 CCTGGGCGGCTGCTGCTGCTGCT 0: 1
1: 8
2: 53
3: 363
4: 1083
Right 1172474522 20:35226873-35226895 CCTCCCGGGCGCCGCGCGGGCGG 0: 1
1: 0
2: 1
3: 30
4: 231
1172474516_1172474522 -9 Left 1172474516 20:35226859-35226881 CCCGCGCTCTGCTGCCTCCCGGG 0: 1
1: 1
2: 4
3: 35
4: 392
Right 1172474522 20:35226873-35226895 CCTCCCGGGCGCCGCGCGGGCGG 0: 1
1: 0
2: 1
3: 30
4: 231
1172474518_1172474522 -10 Left 1172474518 20:35226860-35226882 CCGCGCTCTGCTGCCTCCCGGGC 0: 1
1: 0
2: 5
3: 39
4: 534
Right 1172474522 20:35226873-35226895 CCTCCCGGGCGCCGCGCGGGCGG 0: 1
1: 0
2: 1
3: 30
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172474522 Original CRISPR CCTCCCGGGCGCCGCGCGGG CGG Exonic