ID: 1172477898

View in Genome Browser
Species Human (GRCh38)
Location 20:35252723-35252745
Sequence ATCACAGCAGACTGAAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 211}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172477895_1172477898 0 Left 1172477895 20:35252700-35252722 CCAAGAACTAGATGATGGAGCCC 0: 1
1: 0
2: 1
3: 13
4: 112
Right 1172477898 20:35252723-35252745 ATCACAGCAGACTGAAGCACCGG 0: 1
1: 0
2: 0
3: 14
4: 211
1172477890_1172477898 24 Left 1172477890 20:35252676-35252698 CCATCTCCAAGTCAGATCAGTGG 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1172477898 20:35252723-35252745 ATCACAGCAGACTGAAGCACCGG 0: 1
1: 0
2: 0
3: 14
4: 211
1172477892_1172477898 18 Left 1172477892 20:35252682-35252704 CCAAGTCAGATCAGTGGCCCAAG 0: 1
1: 0
2: 2
3: 10
4: 120
Right 1172477898 20:35252723-35252745 ATCACAGCAGACTGAAGCACCGG 0: 1
1: 0
2: 0
3: 14
4: 211
1172477894_1172477898 1 Left 1172477894 20:35252699-35252721 CCCAAGAACTAGATGATGGAGCC 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1172477898 20:35252723-35252745 ATCACAGCAGACTGAAGCACCGG 0: 1
1: 0
2: 0
3: 14
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172477898 Original CRISPR ATCACAGCAGACTGAAGCAC CGG Intronic
900877355 1:5352662-5352684 ATCAGAACAGAGTGAAGCAATGG + Intergenic
901572203 1:10170093-10170115 ATCACAGCAGGCACAGGCACAGG - Intronic
903617165 1:24668930-24668952 ATCTCAGCTGACTGCAACACAGG - Intronic
903871453 1:26437912-26437934 ATCACAGCTGACTGTAGCCTTGG - Intronic
906793174 1:48676471-48676493 ATCATAGCAGACTGTCTCACAGG + Intronic
906932055 1:50179555-50179577 ATCAAAGCAAACTGAAGCAGAGG - Intronic
907681682 1:56569855-56569877 ATTGCAGCAGAGTGAAGCACAGG - Intronic
909133506 1:71768322-71768344 ATCAGGGCACACTGAAGCAAGGG - Intronic
909300768 1:74010441-74010463 ACTACTGCAGACTGAAGCACAGG - Intergenic
910552325 1:88489709-88489731 GTCAGAGAAAACTGAAGCACAGG + Intergenic
914961252 1:152210372-152210394 ATCCCAGGAGACTGAGGCAGGGG + Intergenic
916249504 1:162723573-162723595 AGCCCAGCAGTCTGAAGCCCTGG + Intronic
916812887 1:168321152-168321174 CTCACAGCACTCTGAAACACAGG + Intergenic
917057809 1:171003479-171003501 ATCACTGCAGTTTGAATCACAGG - Intronic
921769651 1:219021533-219021555 ATCACAGCAGAAAGCAACACAGG + Intergenic
922638423 1:227201211-227201233 ATCACAGCTCACTGCAGCCCAGG + Intronic
1065337741 10:24671794-24671816 TTCACTGCAGACTGGATCACAGG + Intronic
1068117089 10:52747368-52747390 ATCAAGGCAGACTGTACCACAGG + Intergenic
1070467274 10:76736259-76736281 ATCTCTGCAGACTCAAGCATGGG - Intergenic
1070590428 10:77796831-77796853 ATCAGAGCAGAAGGAAGCTCTGG - Intronic
1072639256 10:97199126-97199148 AGCACAGCTGGCTGGAGCACTGG - Intronic
1073365353 10:102935671-102935693 ATCACAGCTCACTGCAGCCCTGG + Intronic
1074024947 10:109624749-109624771 ATCAGAGCAAATTAAAGCACAGG - Intergenic
1076049071 10:127318356-127318378 ATCCCAGCACACTGAAGGAGAGG + Intronic
1079279106 11:19072231-19072253 AGGACAGCAGATGGAAGCACTGG + Intergenic
1080281157 11:30558480-30558502 ATCACAGCTCACTGCAGCTCTGG + Intronic
1081036866 11:38159212-38159234 AGCTGAGCAGACAGAAGCACAGG + Intergenic
1083235630 11:61349084-61349106 AGCACAGCAGTCTGAAGCTTGGG + Exonic
1083580925 11:63824874-63824896 GTCACAGCAAACTGAAGCCTGGG - Intronic
1084382854 11:68824630-68824652 ATCACAGCTCACTGCAGCTCTGG + Intronic
1086227082 11:84525114-84525136 AACACAGAGGACTGAAACACAGG - Intronic
1086620180 11:88878297-88878319 ATCACAACACAGTCAAGCACTGG + Intronic
1092810895 12:12270406-12270428 ATCACAGCTCACTGCAGCATTGG - Intergenic
1094044986 12:26157706-26157728 GTCAGAGCAGAATGAAGCAGGGG - Intronic
1096234202 12:49914749-49914771 ACCACAGCAGAGTAAAGCAATGG + Intergenic
1097510561 12:60533739-60533761 ATAACAGCAGAATGCAGCATTGG - Intergenic
1098335160 12:69396946-69396968 ACCACAGCAAACTGAGGCTCAGG - Intergenic
1098451018 12:70618164-70618186 ATCACAGCTCACTGCAGCCCTGG + Intronic
1099541485 12:83914364-83914386 CTCACTGCAGCCTGAACCACTGG + Intergenic
1100802221 12:98244272-98244294 ATGACAGCTGGCTGAAGCTCAGG - Intergenic
1103848119 12:123913718-123913740 ATCACTTAAGACTGAAGCCCAGG - Intronic
1104746876 12:131216131-131216153 ATCAGAGCAGACAGAAACTCTGG - Intergenic
1104785741 12:131447052-131447074 ATCAGAGCAGACAGAAACTCTGG + Intergenic
1108094248 13:46883810-46883832 ATGACAGGAGATTGAAGCATTGG - Intronic
1108795194 13:54022676-54022698 ATCACACCAGAATGAAGAAAAGG + Intergenic
1108795828 13:54029392-54029414 ATCAAAGCACACTGAAGTTCCGG - Intergenic
1110627386 13:77666516-77666538 ATCTCAGGAGACTGATGCAATGG + Intergenic
1111105027 13:83633984-83634006 GTCACAGCTGACTGCAGCCCTGG - Intergenic
1111274085 13:85924960-85924982 ATCACTGCTGACTGAAGCATCGG - Intergenic
1111961041 13:94811050-94811072 ATCAAAGAAGACTGAAGAAGTGG - Intergenic
1112041319 13:95551624-95551646 ATCACAGCAGACTGATTGATAGG + Intronic
1112935938 13:104798601-104798623 CACAGAGCAGACAGAAGCACTGG - Intergenic
1114667224 14:24386152-24386174 ATCACAGCACTTTGAAGCTCAGG - Intergenic
1116087665 14:40261675-40261697 ATCACAATATACTGAATCACTGG - Intergenic
1116114879 14:40635440-40635462 ATCACAGCAGAAAGCAACACTGG + Intergenic
1116971557 14:51071479-51071501 ATCACAGCACACTGAGCAACTGG - Intronic
1117423466 14:55571538-55571560 ATCACAGCAGAGTGAGACAATGG - Intronic
1119159065 14:72438179-72438201 GTCACAGAAGAGTGAAGCTCAGG + Intronic
1121742237 14:96262277-96262299 AAGAGAGCAGACAGAAGCACAGG + Intronic
1123962361 15:25417690-25417712 GACAAAGCAAACTGAAGCACAGG + Intronic
1126491272 15:49239303-49239325 AGCACAACAGACCAAAGCACTGG - Exonic
1131662806 15:94536762-94536784 ATCACAGAAGGCTGCAGCAGGGG + Intergenic
1132115998 15:99137000-99137022 ATGACAGCAGATTGCAGCACAGG - Exonic
1134297806 16:12962297-12962319 ATGACAGCAGCCTGAAGGCCTGG - Intronic
1135642837 16:24135849-24135871 AGCAAAGCAGGCTGAAGTACAGG - Intronic
1135874137 16:26181743-26181765 AGCACAGCACGCAGAAGCACAGG + Intergenic
1140091458 16:71842424-71842446 ATCAAACCAGAGAGAAGCACTGG - Intergenic
1143413589 17:6728480-6728502 ATCACAGCAGAAAGCAACACTGG + Intergenic
1143777620 17:9209725-9209747 ATACCGGCAAACTGAAGCACTGG - Intronic
1143947715 17:10608681-10608703 AACACAGAAGACTGAGGTACTGG - Intergenic
1144398988 17:14876132-14876154 ATCACAGCTGCCTGAAGAAATGG - Intergenic
1145117566 17:20225511-20225533 ATCACAGCAGAAAGCAACACAGG - Intronic
1152892855 17:82892245-82892267 ATCACAGCAGGCAGGAGCCCAGG - Intronic
1153007137 18:507011-507033 ATCACAGCTCACTGAAGCCTTGG - Intergenic
1154085980 18:11305839-11305861 GTCACAGCAGAAAGAAGAACTGG - Intergenic
1155443300 18:25884467-25884489 ATCACAGCGGAAAGAAACACGGG + Intergenic
1156602573 18:38626689-38626711 AACTCAGAAGACTGAAGCAAAGG - Intergenic
1157298147 18:46460778-46460800 ATCACAGCATACAGAATCAAAGG - Exonic
1158522920 18:58186706-58186728 GTCACAGCAGACTTAAGTGCCGG + Intronic
1159939340 18:74394718-74394740 ATGACAACAGACTAATGCACCGG - Intergenic
1160334622 18:78027689-78027711 GTCACAGCAGACTCAGCCACCGG + Intergenic
1161313105 19:3605678-3605700 AACACAGTAGACAGACGCACAGG + Intronic
1161858339 19:6778657-6778679 ATCACAGCTCACTGCAGCCCAGG - Intronic
1165083441 19:33325716-33325738 TTCTCAGGAGGCTGAAGCACAGG - Intergenic
1167869995 19:52360304-52360326 ATAACAGAAGACTGTAGCAAAGG + Intronic
925183201 2:1830329-1830351 CTCACAGCAGCCTGAAGAAATGG - Intronic
926429920 2:12775397-12775419 ATGCCAGCAAACTTAAGCACAGG + Intergenic
927174707 2:20397632-20397654 ATCACAGCTAACTGAAACACTGG + Intergenic
928249549 2:29663141-29663163 ATCAGAGCAGACTAAACCACGGG + Intronic
929281833 2:40088152-40088174 ATCACAGCAGAAAGCAACACTGG - Intergenic
929625662 2:43403996-43404018 CACACAGCAGGCTGAAGCTCTGG + Intronic
930877895 2:56240258-56240280 ATCACAGGAGGCTGAATCAGAGG - Intronic
933464971 2:82640471-82640493 ATCACAATAGAGTGAATCACAGG + Intergenic
933606804 2:84391832-84391854 ACCATATCAGACAGAAGCACAGG - Intergenic
934160962 2:89249193-89249215 ATCACAGCAGCCTGCTCCACAGG - Intergenic
934206315 2:89933240-89933262 ATCACAGCAGCCTGCTCCACAGG + Intergenic
936055013 2:109256128-109256150 GTCACAGCGGCCAGAAGCACGGG - Intronic
937989474 2:127654297-127654319 ATCAGTGCAGGCTGCAGCACCGG + Intronic
938577625 2:132619259-132619281 ATCACAGCAATTTGAGGCACTGG + Intronic
939873002 2:147545906-147545928 ATATCAGGAAACTGAAGCACAGG + Intergenic
941675409 2:168338642-168338664 ATAACAGGTGACAGAAGCACGGG + Intergenic
942070935 2:172314703-172314725 ATTAAAGCAGAATCAAGCACTGG - Intergenic
947045737 2:225981170-225981192 ATCACAGCTGCCCGAAGCAATGG + Intergenic
948736004 2:240005413-240005435 ATCACAGCACACTGCAGCCTTGG + Intronic
1169383128 20:5126385-5126407 AGCAAAGCAGACTGAAGCGTGGG + Intronic
1171750464 20:29044179-29044201 AACACAGCACACTGCAGCCCAGG - Intergenic
1172477898 20:35252723-35252745 ATCACAGCAGACTGAAGCACCGG + Intronic
1174655592 20:52169624-52169646 GTCACAGCAGAGGGAAACACAGG + Intronic
1175633713 20:60562650-60562672 ATCCCAGGAGACTCCAGCACAGG - Intergenic
1176677032 21:9788474-9788496 AGCACAGCAGAAAGAAGCATGGG - Intergenic
1178750825 21:35301343-35301365 ATGACAGCAAACTGTTGCACAGG + Intronic
1180920793 22:19520633-19520655 CTCAGAGCACACTCAAGCACTGG - Intergenic
1181911841 22:26244667-26244689 CTCACAGGAAACTGAAGCAAAGG + Intronic
1183057221 22:35314426-35314448 GTCACATCAGACTCATGCACGGG + Intronic
1183725890 22:39589607-39589629 ATCTCAGCACCCTGAGGCACAGG + Intronic
1184588082 22:45461171-45461193 TTCTCAGGAGGCTGAAGCACGGG + Intergenic
1185001212 22:48247274-48247296 ATCTCAGGAGGCTGAAGCAGGGG + Intergenic
949911509 3:8913380-8913402 ATCAAAGCTGCCTGATGCACAGG + Intronic
950148769 3:10669913-10669935 ATCCCAACAGGCGGAAGCACTGG + Intronic
951583129 3:24186613-24186635 CTTACAGCAGACAGAAGCATAGG + Intronic
951650991 3:24951299-24951321 ATCACAGTACTCTGAAGAACTGG + Intergenic
952543481 3:34394023-34394045 ATCAGAGCAGAATGAAACATAGG - Intergenic
953149456 3:40310407-40310429 AGCAGAGAAGACTGAACCACTGG - Intronic
953356460 3:42260333-42260355 ATCACAGCAGGCAGAAGGATGGG - Intronic
954311307 3:49770130-49770152 ATCACAGCTTACTGCAGCCCTGG - Intronic
954337233 3:49926521-49926543 ATCACAGCTAACTGTAGCCCTGG + Intronic
956253862 3:67263336-67263358 ATCACAGCACCATGATGCACTGG + Intergenic
957744465 3:84321067-84321089 ATGACAGCTGACTAGAGCACTGG - Intergenic
960998763 3:123358270-123358292 AATACAGCAGACTGCAGCCCTGG + Intronic
962951485 3:140223672-140223694 AGCACAGTAGACAGAGGCACAGG - Intronic
962974283 3:140432699-140432721 ATCAAAGCAGACTTGAGCATGGG - Intronic
964480649 3:157135127-157135149 AGCAGAGCAAACTGAAGCAGTGG - Intergenic
964524245 3:157600838-157600860 ATCACAGCAGGCTGAAGGCCAGG - Exonic
965846541 3:172968814-172968836 ATCAAAGCAAAATGAAACACAGG + Intronic
965980192 3:174681083-174681105 GTCACAGCAGAAAGAAACACTGG + Intronic
966117072 3:176477711-176477733 ATCACACTAGAAAGAAGCACTGG - Intergenic
969375528 4:6761010-6761032 AGCAGAGGAGACTGAAGCTCAGG - Intergenic
970260721 4:14221483-14221505 CTCACAGCACAGTGAAGAACAGG - Intergenic
970538697 4:17055912-17055934 ATCACATAAGACTGCAGCAAGGG - Intergenic
972493404 4:39609883-39609905 ATGACAGCATATTGAATCACTGG + Intronic
973919935 4:55674275-55674297 ATTACAGCAGAAAGCAGCACTGG - Intergenic
977928677 4:102729148-102729170 ATCACAGATGTCTGCAGCACAGG - Intronic
978579929 4:110221352-110221374 ATTACAGCACAGTGAAGCAAGGG + Intergenic
979991152 4:127377230-127377252 ACATCAGCAGACTGAAGGACAGG + Intergenic
982586502 4:157247763-157247785 TTCACACCAGAATGAGGCACAGG + Intronic
985308079 4:188565674-188565696 ATCACAGCAAAATTAAGCAGAGG + Intergenic
985398512 4:189570310-189570332 AGCACAGCAGAAAGAAGCATGGG + Intergenic
985498464 5:224887-224909 GTCCCAGAAGACAGAAGCACAGG - Intronic
988112697 5:26843425-26843447 ATCACAGCTCACTGAAGCCTCGG - Intergenic
989240248 5:39195088-39195110 ATTACAGGACACTGAATCACTGG - Intronic
992935800 5:81703359-81703381 AGCACTGCAGACTGTAGCTCAGG - Intronic
995573254 5:113503450-113503472 ATCACTGCAGGCTAAAGCTCTGG - Intergenic
997230233 5:132237218-132237240 ATCACAAAAGCCTGAATCACTGG + Intronic
998090802 5:139366991-139367013 ATCACAGCTCACTGCAGCATCGG - Intronic
998360744 5:141584555-141584577 ATCTCTTCAGACTGAAGCACTGG + Intronic
1000246589 5:159453388-159453410 ACCACAGCTGACTGAACCACAGG - Intergenic
1000334923 5:160235104-160235126 ATTTGAGGAGACTGAAGCACAGG + Intronic
1001601578 5:172932403-172932425 GACACAGCAGAATGAAGCAGGGG - Intronic
1002652323 5:180708127-180708149 ACCACAGGAGGCTGAAGCCCAGG - Intergenic
1002876600 6:1215993-1216015 ATCCTAGAAGCCTGAAGCACTGG - Intergenic
1003145029 6:3503105-3503127 CCCAAAGCAGACAGAAGCACAGG + Intergenic
1004022909 6:11790625-11790647 ATCACAGCAGCCACAGGCACTGG + Intronic
1004559760 6:16737612-16737634 ATGCCAGCAGCCTTAAGCACAGG + Intronic
1005896333 6:30182225-30182247 CTCACAGCAGCCTGTAGCAGTGG + Intergenic
1010963801 6:82179104-82179126 ATCACACCAGACTGACTCAGAGG + Intronic
1011656805 6:89559532-89559554 ATCAGAGCAGATTTAAGCAATGG + Intronic
1011750434 6:90449755-90449777 ATCACTGCATACTGAAGCCCTGG + Intergenic
1011900153 6:92284276-92284298 ATCACAGCATACCACAGCACTGG - Intergenic
1014075551 6:117230704-117230726 TTCAGAGCAGACTGATGCAATGG + Intergenic
1014513048 6:122348542-122348564 ATGACAGCAGACTAAAGTAGGGG + Intergenic
1014840236 6:126210886-126210908 AGTAAACCAGACTGAAGCACCGG - Intergenic
1016857034 6:148680985-148681007 ATCACAGCTTACTGAAGCCTTGG - Intergenic
1018941346 6:168310379-168310401 GTCACTGCAGACGGAGGCACAGG + Exonic
1018981018 6:168601864-168601886 ATGACAGCGGAATGAAGCCCAGG - Intronic
1019150581 6:170003017-170003039 ATCACAGCAGACTCCAGAGCAGG + Intergenic
1019195305 6:170278083-170278105 ATCACAGCTCACTGAAGCCTCGG + Intergenic
1019199552 6:170303311-170303333 CTCACTGCAGACTGAAACTCTGG + Intronic
1021937382 7:25644616-25644638 ATCACAGCTGAATCAAGCACAGG + Intergenic
1022175276 7:27866406-27866428 AACAGAGCAGAATGAAGCACAGG - Intronic
1022429708 7:30304592-30304614 ATCACAGAAAAATGAAGCAATGG - Intronic
1022801751 7:33783283-33783305 ATCACAGTAGAGAGAAGTACTGG - Intergenic
1023100245 7:36710486-36710508 CTCAAATCAGACTGAAGCCCTGG + Intronic
1023888647 7:44377543-44377565 ACCACAGCTGACTGGAGCAGAGG - Intergenic
1025241253 7:57277988-57278010 GTGACAGCAGAGTGAACCACTGG + Intergenic
1025923704 7:65939134-65939156 ATCACAACTGACTGAGGCAGTGG + Intronic
1026259820 7:68745354-68745376 ATCACAGCTCACTGAAGCCTCGG + Intergenic
1031354259 7:120770532-120770554 ATCAAAGCAGGCTGAAGTTCTGG - Intergenic
1033951925 7:146795572-146795594 GTCACAGCTGTCTGAAGCAGGGG + Intronic
1034417805 7:150974494-150974516 ATCTCAGCAGAGTGAGGCGCAGG + Intronic
1034669311 7:152846115-152846137 CTCACTGCAGACTGCAGCCCAGG - Intronic
1034669341 7:152846302-152846324 CTCACTGCAGACTGCAGCCCAGG - Intronic
1035921929 8:3686607-3686629 AGCACAGAAAACTGAAGCCCAGG + Intronic
1035987936 8:4455013-4455035 ATGACAGCGGACTGACACACTGG - Intronic
1037457538 8:19078869-19078891 ATCAGAGAAGACTGAAGAATGGG + Intronic
1038709878 8:29933672-29933694 ATCAAGGCACACTGATGCACTGG - Intergenic
1043370286 8:79583644-79583666 ATCACAGCAGCCTGGAGGCCTGG + Intergenic
1043958212 8:86387127-86387149 ATGCCATCAGACTGAAGCAGAGG + Intronic
1044777770 8:95711180-95711202 ATCATAGCAGCCAGAAGCAATGG - Intergenic
1045366149 8:101478005-101478027 ATCACAGCTCACTGCAGCCCAGG + Intergenic
1046557196 8:115789992-115790014 GTCACAGCAGAAAGAAACACTGG + Intronic
1047134532 8:122061369-122061391 ATCACATCAGCCTGAAGTAATGG + Intergenic
1047788758 8:128180891-128180913 ATCAAAGCTGGCTGAAGCAATGG + Intergenic
1048035514 8:130673784-130673806 CTCACAACAGACTGAGGCATGGG + Intergenic
1049751255 8:144285315-144285337 ATCACATCAGACTGGAACAGTGG - Intronic
1052287413 9:26802111-26802133 GTGCCAGGAGACTGAAGCACAGG + Intergenic
1054344450 9:63900308-63900330 AACACAGCACACTGCAGCTCAGG + Intergenic
1055283558 9:74702863-74702885 ATCACAGAAGAATACAGCACAGG + Intergenic
1055751969 9:79516338-79516360 ATCACAGCTCACTGAAGCCTTGG - Intergenic
1056626805 9:88260485-88260507 ATCAAGGCAGGCTGCAGCACGGG + Intergenic
1058348544 9:103993789-103993811 ACCACAGGAAACTGAAGCAGAGG - Intergenic
1058802210 9:108555534-108555556 ATCACAGCACACTCAAGCCTAGG - Intergenic
1061756282 9:132814717-132814739 CCCACAGCAGACTGAAGGAGAGG + Exonic
1062598627 9:137310315-137310337 CTCACTGCAGCCTGAAGCCCCGG + Intronic
1185431197 X:13068-13090 ATCACAGCTGACTGCAGCCTCGG + Intergenic
1185431999 X:16748-16770 ATCACAGCTGACTGCAGCCTCGG + Intergenic
1185440464 X:225465-225487 ATCACAGCTGACTGCAGCCTCGG + Intergenic
1185441315 X:229462-229484 ATCACAGCTGACTGCAGCCTCGG + Intergenic
1185612339 X:1400154-1400176 ATTACAGCAGCCTGCAGCACTGG + Intergenic
1189536777 X:41943358-41943380 AACAAAGCAGAGTGAAGCAATGG + Intergenic
1193571189 X:83146511-83146533 ATCACAGCCGATTGTATCACAGG + Intergenic
1196051262 X:111307767-111307789 GTCCCAGCACACTGAACCACTGG + Intronic
1197846664 X:130810786-130810808 ATCCCAGTAGACCCAAGCACTGG + Intronic
1198059413 X:133029970-133029992 ATCAAGGCAGAATGAAGAACAGG - Intronic
1201153992 Y:11113276-11113298 ATCAAAGCATACTGTAGCATGGG + Intergenic
1201768847 Y:17598224-17598246 ATCTCAGCTCACTGCAGCACAGG + Intergenic
1201832707 Y:18307761-18307783 ATCTCAGCTCACTGCAGCACAGG - Intergenic