ID: 1172479027

View in Genome Browser
Species Human (GRCh38)
Location 20:35260203-35260225
Sequence AGGGGGAGACAGAGGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2699
Summary {0: 1, 1: 1, 2: 14, 3: 266, 4: 2417}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172479027_1172479040 14 Left 1172479027 20:35260203-35260225 CCCTGCTCCCTCTGTCTCCCCCT 0: 1
1: 1
2: 14
3: 266
4: 2417
Right 1172479040 20:35260240-35260262 GTTTCTGTGCAGCAGGATACTGG 0: 1
1: 0
2: 1
3: 16
4: 184
1172479027_1172479033 -9 Left 1172479027 20:35260203-35260225 CCCTGCTCCCTCTGTCTCCCCCT 0: 1
1: 1
2: 14
3: 266
4: 2417
Right 1172479033 20:35260217-35260239 TCTCCCCCTCAGGGCTCTCTTGG 0: 1
1: 0
2: 3
3: 28
4: 280
1172479027_1172479034 -8 Left 1172479027 20:35260203-35260225 CCCTGCTCCCTCTGTCTCCCCCT 0: 1
1: 1
2: 14
3: 266
4: 2417
Right 1172479034 20:35260218-35260240 CTCCCCCTCAGGGCTCTCTTGGG 0: 1
1: 0
2: 1
3: 20
4: 238
1172479027_1172479039 7 Left 1172479027 20:35260203-35260225 CCCTGCTCCCTCTGTCTCCCCCT 0: 1
1: 1
2: 14
3: 266
4: 2417
Right 1172479039 20:35260233-35260255 CTCTTGGGTTTCTGTGCAGCAGG 0: 1
1: 0
2: 1
3: 18
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172479027 Original CRISPR AGGGGGAGACAGAGGGAGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr