ID: 1172479320

View in Genome Browser
Species Human (GRCh38)
Location 20:35261627-35261649
Sequence CTGTTGGCTAAGATTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172479320_1172479323 -1 Left 1172479320 20:35261627-35261649 CCTGCCTCAATCTTAGCCAACAG 0: 1
1: 0
2: 1
3: 11
4: 121
Right 1172479323 20:35261649-35261671 GTTCCCTGCTTCCACAACCAAGG No data
1172479320_1172479330 26 Left 1172479320 20:35261627-35261649 CCTGCCTCAATCTTAGCCAACAG 0: 1
1: 0
2: 1
3: 11
4: 121
Right 1172479330 20:35261676-35261698 GCAGAGAGCTGCCCACGCCCGGG 0: 1
1: 0
2: 2
3: 24
4: 247
1172479320_1172479329 25 Left 1172479320 20:35261627-35261649 CCTGCCTCAATCTTAGCCAACAG 0: 1
1: 0
2: 1
3: 11
4: 121
Right 1172479329 20:35261675-35261697 TGCAGAGAGCTGCCCACGCCCGG 0: 1
1: 0
2: 1
3: 26
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172479320 Original CRISPR CTGTTGGCTAAGATTGAGGC AGG (reversed) Intronic
901056698 1:6451650-6451672 CTACTGGCTGAGATTAAGGCAGG + Exonic
902477668 1:16696855-16696877 CTACTGGCTGAGATTAAGGCAGG - Intergenic
907340406 1:53731353-53731375 CTGTTGGCTGAGACTGAGAAAGG + Intronic
908183274 1:61627054-61627076 CTCTTGGCCAAGATGGAGTCTGG - Intergenic
911289011 1:96032644-96032666 CAGTTGGCTAAGAATAATGCTGG - Intergenic
911367562 1:96956763-96956785 CTGTTTACTAAGATTTAGGTAGG + Intergenic
916619895 1:166485960-166485982 CAGTTGGCTCAGGGTGAGGCTGG - Intergenic
916990731 1:170241697-170241719 CTGATGGCTAAGAGAGAGCCTGG - Intergenic
917245828 1:172999227-172999249 GTGATGGCTAGAATTGAGGCAGG - Intergenic
920276043 1:204805134-204805156 CTGTGGGCCAAGAGTCAGGCTGG - Intergenic
924617296 1:245622801-245622823 CTGCTGCCTGGGATTGAGGCGGG + Intronic
1064100152 10:12456653-12456675 CTGTTGTCCCAGGTTGAGGCGGG + Intronic
1064655158 10:17549367-17549389 CTGGAGGCTAAGATTCAGCCAGG + Intergenic
1068227997 10:54131973-54131995 CTGATGGTAAAGATTGATGCTGG + Intronic
1070063807 10:73013445-73013467 TTGAAGGCTAAGGTTGAGGCTGG - Intronic
1074889706 10:117725305-117725327 CTGTGGGCTAAGAATGAGGCTGG - Intergenic
1078483808 11:11703813-11703835 TTGTTGGCTAACATGGAGGATGG - Intergenic
1079493247 11:21012585-21012607 CAGTTCGCTAAAAATGAGGCTGG + Intronic
1079621899 11:22566169-22566191 CTGTTGTCTAAGAGTGTGGTTGG + Intergenic
1082956832 11:58878916-58878938 CTTTTGGCTAAGAATGAGTTGGG + Intronic
1089003989 11:115075413-115075435 CTGTTGTGTAATATTGTGGCAGG + Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091738114 12:2940030-2940052 CTCTTGACTAAGATTGGTGCCGG - Intronic
1094216033 12:27943757-27943779 CTCTTATCAAAGATTGAGGCTGG + Intergenic
1097374048 12:58819290-58819312 CTGTTGGCTGAGAGAGAAGCTGG - Intergenic
1098022560 12:66170826-66170848 CAGGTGGCAAAGAATGAGGCTGG + Intergenic
1098606383 12:72395883-72395905 TCATTGGCTAAGATTGAGGAAGG - Intronic
1101970543 12:109309450-109309472 CTGTTGGCAAAGTTTGAAGAGGG - Intergenic
1103221337 12:119248313-119248335 CTACTCGCTAAGACTGAGGCAGG + Intergenic
1103356840 12:120327859-120327881 CTCTTGGCTGAGTTTGGGGCTGG + Intergenic
1105778292 13:23682696-23682718 CTGTTGGCTAAGAATGGGTTTGG + Intergenic
1106188553 13:27429207-27429229 GTGATGGCTAAGATTGAGCCTGG + Intronic
1106484951 13:30163761-30163783 CTCCAGGCTAAGGTTGAGGCTGG + Intergenic
1110631834 13:77717639-77717661 CTGTTGGCTAGGATTGTGTCTGG + Intronic
1111531370 13:89541626-89541648 CTGTGGCCTGAGCTTGAGGCAGG - Intergenic
1113207738 13:107936856-107936878 CTTTTGGCTAAGGCTGAGGAGGG - Intergenic
1115804901 14:37039858-37039880 CTTGAGGCTAAGCTTGAGGCAGG + Intronic
1116255793 14:42553329-42553351 CTTTTGGCTGAGAAAGAGGCTGG - Intergenic
1117966491 14:61211883-61211905 CTCTTGGCTAGGACTGTGGCAGG - Intronic
1120006226 14:79361042-79361064 CTGTTAGCTATGATGAAGGCAGG + Intronic
1121666682 14:95677657-95677679 CTGTTGGCCAAGGTTGAGCCTGG - Intergenic
1128395733 15:67223560-67223582 GTGATGGCTCAGATTGGGGCTGG - Intronic
1129373543 15:75113137-75113159 CTTCTGGCTCAGATGGAGGCAGG - Intronic
1129578346 15:76778042-76778064 CTGTTGGGTAAGATTCAGCATGG + Intronic
1132417971 15:101637948-101637970 CTGATAGCTAGGAGTGAGGCAGG + Intronic
1135267611 16:21041026-21041048 CTGTTGGCTGGGATGGATGCAGG + Intronic
1136486255 16:30573525-30573547 CTGTTTGCTAAGCGTGGGGCTGG + Intergenic
1141851454 16:86649123-86649145 CTGTTGGCCCAGATTAAGCCTGG + Intergenic
1143967746 17:10768885-10768907 CTGATGGCTGAGATTCAAGCTGG - Intergenic
1146577583 17:34008363-34008385 CAGCTTGTTAAGATTGAGGCTGG + Intronic
1147269757 17:39260552-39260574 AGGTTGGCAAAGATTCAGGCAGG + Intronic
1156031616 18:32719907-32719929 CTATTGGCTGAGATTGAAGTAGG - Intronic
1156511721 18:37642358-37642380 CTGGTTGCTAAGATAGAGGCTGG + Intergenic
1159358189 18:67364140-67364162 CTGTGGGCCATGATAGAGGCTGG + Intergenic
1161490318 19:4557714-4557736 AGGCTGGCTATGATTGAGGCTGG - Intronic
1161704636 19:5813642-5813664 CTGTTGCCCAAGCTGGAGGCTGG - Intergenic
1161962586 19:7530698-7530720 CTGTTGGCAAAGACTGACTCAGG - Intronic
1164035360 19:21449367-21449389 CTGCTGGTTTAGAGTGAGGCTGG - Intronic
1168509912 19:56966178-56966200 CTCTTGGCTCAGATAGAGGTGGG + Intergenic
1202711685 1_KI270714v1_random:22681-22703 CTACTGGCTGAGATTAAGGCAGG - Intergenic
925695082 2:6568075-6568097 TTATAGGCTAAGTTTGAGGCTGG - Intergenic
931573800 2:63698529-63698551 CTGTTGGCACAGACTGAGGCTGG + Intronic
931690632 2:64832025-64832047 CTGTGGCCTAAGGTTTAGGCAGG - Intergenic
931741523 2:65250000-65250022 CTCTTGGCCCAGATTGAGGGAGG + Intronic
933688952 2:85164359-85164381 CTCTTGCCTAAGATGAAGGCTGG + Intronic
934720170 2:96568631-96568653 CTGCTGGCTCAGGTTGAGGGTGG + Intergenic
935607187 2:104982972-104982994 CTGGTGGCCAAGTTTGAGGCAGG + Intergenic
935797078 2:106653387-106653409 CTCTTTGCTACGACTGAGGCTGG - Intergenic
936269908 2:111041618-111041640 CTCTTGGCTAAGACTGGAGCAGG + Intronic
939403784 2:141730180-141730202 ATGGTGGCTGAGACTGAGGCTGG - Intronic
942575862 2:177362859-177362881 CTATTTGCTGAGAGTGAGGCAGG - Intronic
945704646 2:213213948-213213970 CTTTTGGCTAAGAATGAGTTTGG - Intergenic
946122407 2:217527831-217527853 CTGTTACCTAATATTTAGGCTGG - Intronic
947150656 2:227111838-227111860 GTGTTGACTAAAATTGAGGAAGG + Intronic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1172309777 20:33908570-33908592 CAGTGGGATCAGATTGAGGCTGG + Intergenic
1172479320 20:35261627-35261649 CTGTTGGCTAAGATTGAGGCAGG - Intronic
1178707498 21:34888023-34888045 ATGTTGGTTAAGTTTGTGGCTGG + Intronic
1184249904 22:43254028-43254050 CTGTTGGCTGGGGCTGAGGCTGG + Intronic
950734777 3:14997609-14997631 CTCTTGGCTAAGAAATAGGCAGG - Intronic
951617312 3:24562087-24562109 CTTGAGGCTAAGACTGAGGCAGG + Intergenic
953373833 3:42412214-42412236 GTGTTGGCTCAGCTGGAGGCTGG + Intergenic
953644965 3:44745383-44745405 CTCTTTGCTAAGCATGAGGCAGG - Intronic
956185354 3:66557216-66557238 CTGTTGCCTGAGATTGAGAGTGG + Intergenic
963419832 3:145047794-145047816 GTTTTGACTAAGATTGAGGCTGG - Intergenic
964489214 3:157216947-157216969 CTGGTGGCCAAGAAGGAGGCAGG + Intergenic
966150279 3:176860476-176860498 CTGTTGGCAAATACTGAGCCTGG + Intergenic
970540418 4:17072626-17072648 CTGTGGGATCAGATTGAGTCTGG + Intergenic
973974986 4:56254143-56254165 CTATTGTCTAAGATTTAGTCTGG + Intronic
975570174 4:75808373-75808395 CTGATGCCTAAGATTGAGACAGG + Intronic
979110971 4:116756156-116756178 CTGTTGGTTGAGATAAAGGCTGG + Intergenic
984366413 4:178804990-178805012 CTGATGGTTAAGAGTCAGGCTGG - Intergenic
985171814 4:187158138-187158160 CTGAGGGCTGAGGTTGAGGCAGG - Intergenic
985988218 5:3535181-3535203 CTGTGGGCTAAGAATGAACCTGG + Intergenic
987418033 5:17685035-17685057 CTGATGGGTAAGACTGGGGCTGG - Intergenic
987660923 5:20874691-20874713 CTGTAGTCCAAGATTGTGGCTGG + Intergenic
988762717 5:34330994-34331016 CTGTAGTCCAAGATTGTGGCTGG - Intergenic
993442659 5:87975805-87975827 CTGTGGTCTAAGATTAAGGTTGG + Intergenic
999976981 5:156921681-156921703 CTTTTGGCTAGGATTGTTGCAGG - Intronic
1002140143 5:177133244-177133266 CTGTAACCTAAGATGGAGGCCGG + Intronic
1003520889 6:6857348-6857370 CTGCTGGCTGTGCTTGAGGCAGG + Intergenic
1005278679 6:24247032-24247054 CAGTTTGCTAAGACTCAGGCTGG + Intronic
1006267965 6:32941130-32941152 CTGTTGTCTAAGACTAAGGCAGG - Intronic
1008652706 6:53579345-53579367 CTGTTCGCTTTGCTTGAGGCTGG + Intronic
1011801748 6:91023824-91023846 CTGTTGGCTAAGAGTTTAGCTGG + Intergenic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1017293689 6:152770180-152770202 CTGTTGACCAAGGTTGAGGCAGG - Intergenic
1019730796 7:2628330-2628352 CAGAAGGCTGAGATTGAGGCGGG + Intergenic
1019772167 7:2890512-2890534 CTGTTGTCTATGGTGGAGGCAGG + Intergenic
1020250077 7:6460486-6460508 CTGTTGGCAAAGCTCGTGGCTGG - Intronic
1027053238 7:75032617-75032639 CTGTGGGCCAAGGGTGAGGCAGG - Intronic
1027338955 7:77185138-77185160 CTGTTTGCTATGATTAATGCTGG - Intronic
1027963088 7:84971766-84971788 CTCTTTGCTAAGTTTGAGGAGGG - Intergenic
1029167347 7:98601991-98602013 ATGTTGTCTCAGATTTAGGCTGG + Intergenic
1031692856 7:124812128-124812150 CTGTTGGCTAATCTAAAGGCAGG - Intergenic
1034176406 7:149103538-149103560 CTGTTGGCTCAAGTTGAGGCAGG - Exonic
1038112424 8:24514107-24514129 CTTTTGGCTAGGATTGGGGAGGG - Intronic
1040636113 8:49274860-49274882 CAGCCGGCTAAGATGGAGGCAGG - Intergenic
1049326262 8:142023096-142023118 CTGTGGGGGAAGATTGGGGCAGG - Intergenic
1050594148 9:7189027-7189049 CTGTTAGCTTAGACTGTGGCAGG + Intergenic
1051891617 9:21948101-21948123 CTGTGGTCTAAGATTGTGGTTGG - Intronic
1054343426 9:63890374-63890396 CTGTGGACTCAGATTGAGCCAGG - Intergenic
1059477375 9:114558389-114558411 CTGCTGGCTGAGGTTGAGGGTGG - Intergenic
1062074339 9:134576311-134576333 CTGGTGGCCAAGATAGAAGCAGG - Intergenic
1189440413 X:41030964-41030986 CAGTGAGCTAAGATTGAGACTGG + Intergenic
1190833505 X:54080047-54080069 CTGTGGGAAAAGCTTGAGGCAGG + Intronic
1191005917 X:55711525-55711547 CTTTTGGCTAAGAATGAGTTTGG - Intergenic
1191021709 X:55867513-55867535 CTGTTTTCTAAGAATGAAGCAGG + Intergenic
1194360146 X:92940391-92940413 CTGTGGGATCAGACTGAGGCTGG + Intergenic
1196528331 X:116752936-116752958 CTGTTGGATGACATTGAGGTTGG + Intergenic
1196801441 X:119546827-119546849 GTGTAGGCTAAGATAGTGGCAGG - Intronic
1198102562 X:133434809-133434831 CTGTAGCCTGAGACTGAGGCAGG - Intergenic
1198756381 X:139986867-139986889 CTGTTGCCCAGGATGGAGGCTGG + Intergenic
1200668349 Y:6056213-6056235 CTGTGGGATCAGACTGAGGCTGG + Intergenic