ID: 1172483749

View in Genome Browser
Species Human (GRCh38)
Location 20:35286781-35286803
Sequence CTGCTCGCACGGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172483749_1172483759 8 Left 1172483749 20:35286781-35286803 CCCAGCTCCAGCCGTGCGAGCAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1172483759 20:35286812-35286834 ATCGGGAGACCATTGGGCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 52
1172483749_1172483755 -10 Left 1172483749 20:35286781-35286803 CCCAGCTCCAGCCGTGCGAGCAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1172483755 20:35286794-35286816 GTGCGAGCAGGGCTTGATATCGG 0: 1
1: 0
2: 0
3: 3
4: 57
1172483749_1172483765 27 Left 1172483749 20:35286781-35286803 CCCAGCTCCAGCCGTGCGAGCAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1172483765 20:35286831-35286853 CAGGCCCCTCACCACGGAATGGG 0: 1
1: 0
2: 1
3: 5
4: 75
1172483749_1172483758 2 Left 1172483749 20:35286781-35286803 CCCAGCTCCAGCCGTGCGAGCAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1172483758 20:35286806-35286828 CTTGATATCGGGAGACCATTGGG 0: 1
1: 0
2: 0
3: 2
4: 56
1172483749_1172483756 -9 Left 1172483749 20:35286781-35286803 CCCAGCTCCAGCCGTGCGAGCAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1172483756 20:35286795-35286817 TGCGAGCAGGGCTTGATATCGGG 0: 1
1: 0
2: 0
3: 4
4: 100
1172483749_1172483757 1 Left 1172483749 20:35286781-35286803 CCCAGCTCCAGCCGTGCGAGCAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1172483757 20:35286805-35286827 GCTTGATATCGGGAGACCATTGG 0: 1
1: 0
2: 0
3: 3
4: 44
1172483749_1172483764 26 Left 1172483749 20:35286781-35286803 CCCAGCTCCAGCCGTGCGAGCAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1172483764 20:35286830-35286852 CCAGGCCCCTCACCACGGAATGG 0: 1
1: 0
2: 2
3: 16
4: 145
1172483749_1172483761 21 Left 1172483749 20:35286781-35286803 CCCAGCTCCAGCCGTGCGAGCAG 0: 1
1: 0
2: 0
3: 16
4: 130
Right 1172483761 20:35286825-35286847 TGGGCCCAGGCCCCTCACCACGG 0: 1
1: 0
2: 1
3: 35
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172483749 Original CRISPR CTGCTCGCACGGCTGGAGCT GGG (reversed) Exonic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
901066069 1:6495241-6495263 CTGCTGGCACGGATGGTGCCTGG - Intronic
902652548 1:17846009-17846031 CAGCTGGCCTGGCTGGAGCTCGG - Intergenic
903192363 1:21663843-21663865 CTGCTGGCAAGGCTGGGGTTTGG - Intronic
903520960 1:23949430-23949452 CTTCTCCTTCGGCTGGAGCTCGG + Intergenic
905288992 1:36908466-36908488 CTTCTTGCATGGGTGGAGCTTGG - Intronic
908339359 1:63160813-63160835 CTGCTGGCACAGCTTGATCTGGG + Intergenic
909803687 1:79847830-79847852 CTGCAGGGACGGCTGCAGCTGGG - Intergenic
910221461 1:84893109-84893131 CTCCGCGCCCGGCTGGAGCCCGG - Intronic
912977366 1:114342684-114342706 CTGCTGGCACCACTGGCGCTGGG - Intergenic
914899357 1:151703610-151703632 CTGCTCTCATGGCTGGGGGTGGG - Intronic
919767205 1:201135151-201135173 CTGTCCTCAGGGCTGGAGCTGGG + Exonic
919804828 1:201375361-201375383 CTGCTCCCTCTGCTGGAGCAGGG + Intronic
920711853 1:208302854-208302876 CTGCTCACAGGGGTGGAGTTGGG + Intergenic
922496667 1:226062785-226062807 CTTCTCCTTCGGCTGGAGCTCGG - Intronic
922505352 1:226122573-226122595 CTGCACGCACGGCCGGCGCGGGG + Intergenic
923008269 1:230068332-230068354 CTGCTCTCCCGGCCGGCGCTCGG - Intronic
923561888 1:235047799-235047821 CTTCTCCCAAGGTTGGAGCTGGG - Intergenic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1072766458 10:98098492-98098514 CTGACCGCACAGCAGGAGCTGGG - Intergenic
1076115107 10:127890033-127890055 CTGCACTCACTGCTGGAGCATGG - Intronic
1077353509 11:2104013-2104035 CTGCGACCATGGCTGGAGCTGGG - Intergenic
1079238453 11:18706109-18706131 CTTCTCGTAGGGCTTGAGCTTGG + Exonic
1080907950 11:36565503-36565525 CTGCGCTCAAGGCTGGAGCTTGG + Intronic
1081937999 11:46918148-46918170 CCGCTCGGACTGCTGGAGCCGGG + Intronic
1082768520 11:57187435-57187457 CTGCTGCCACCGCTGGAGCAAGG + Exonic
1085769679 11:79313722-79313744 CTGTTGTCACTGCTGGAGCTCGG - Intronic
1086439623 11:86815139-86815161 CTGTTCCCACGGCTGCTGCTTGG - Intronic
1091225141 11:133952451-133952473 CTGCTCTCAGGGCTGCAGCACGG + Intronic
1097320154 12:58216633-58216655 CTTCTCACTCTGCTGGAGCTGGG + Intergenic
1097712891 12:62934749-62934771 CTGCTCGCACCGCTGCAGCCGGG - Exonic
1099767887 12:87012737-87012759 CTGCTTGCAAGGTTGGACCTTGG + Intergenic
1102950645 12:117028514-117028536 CGGCCTGCAGGGCTGGAGCTGGG - Exonic
1103073038 12:117960531-117960553 CTGCTCACATGGCTGGTGGTTGG - Intronic
1104369199 12:128208015-128208037 CTGCTTGCAAGGCTGGACCTAGG + Intergenic
1104558525 12:129823496-129823518 CTGCTGGCAAGGCTGGCCCTTGG - Intronic
1104772004 12:131369399-131369421 GTGCTCGGAGGGCAGGAGCTGGG - Intergenic
1104896830 12:132168824-132168846 CTGCTCCCACGGCGGGTGGTGGG + Intergenic
1112286813 13:98111832-98111854 CTGCTTGCAAGGCTGGCCCTGGG + Intergenic
1113890113 13:113731231-113731253 CTCCTCGCCCTGCAGGAGCTCGG - Exonic
1113902257 13:113803830-113803852 CTGCCCGCACCCCTGGGGCTGGG - Intronic
1121260177 14:92560120-92560142 CTTCTCGCACCACTGAAGCTGGG - Intronic
1121473666 14:94174915-94174937 CTGCCCCGAGGGCTGGAGCTCGG - Intronic
1122613729 14:103002658-103002680 CTGCTCGCCAGGCTGGGGCTGGG + Intronic
1124139945 15:27068285-27068307 ATGCTCGCACTGCAGGAGCTGGG + Intronic
1125600818 15:40915013-40915035 CAGCTCGCCTGGCTGGATCTGGG + Intergenic
1127616410 15:60690410-60690432 TTGCCCACATGGCTGGAGCTGGG - Intronic
1129904268 15:79175072-79175094 ATGACTGCACGGCTGGAGCTGGG + Intergenic
1131376202 15:91925833-91925855 CTTCAAGCACGGCTGGATCTAGG - Intronic
1135572688 16:23561360-23561382 CTGCTTGGAAGGCTGGAACTAGG - Intronic
1136280384 16:29205294-29205316 CTGCTACCTGGGCTGGAGCTGGG - Intergenic
1139939181 16:70592200-70592222 CTGCTGGCCCGGCTGAGGCTGGG + Intronic
1140547056 16:75820923-75820945 CTATTCGCAAGGCTGGAGCAGGG - Intergenic
1141647413 16:85375158-85375180 CAGCTCGCACAGCCTGAGCTGGG - Intergenic
1141854607 16:86672597-86672619 CTGCTCACACAGCTGGAACCCGG - Intergenic
1143326941 17:6105192-6105214 CTGGACGCACGGCTAGTGCTGGG - Intronic
1144510553 17:15871471-15871493 CTGCTTGCAAGGCTGGCCCTTGG + Intergenic
1144947718 17:18978274-18978296 CTGCTTCCACAGCTGGTGCTGGG + Exonic
1145122074 17:20269209-20269231 CTGCTTGCAAGGCTGGCCCTTGG + Intronic
1145174713 17:20689196-20689218 CTGCTTGCAAGGCTGGCCCTTGG + Intergenic
1146058681 17:29593502-29593524 CTGCTCGCGGGGCTGCGGCTCGG - Exonic
1148549451 17:48541942-48541964 CTTCTCGCCCGGCTGCTGCTTGG + Intronic
1148655260 17:49278399-49278421 CTGCTCACACTGCAGGAGCTGGG + Intergenic
1148885602 17:50770096-50770118 CTGATCGCAGGGCTGGGGCAGGG - Intergenic
1152026698 17:77814306-77814328 CTGTTGGCTCGGCTGGCGCTGGG - Intergenic
1152637813 17:81437329-81437351 CTGCACGGAGGGCTGGGGCTGGG + Intronic
1152842425 17:82578865-82578887 CTGCTCACATGGCTGGAGTATGG + Intronic
1154274076 18:12944853-12944875 CTGCTAGTACTGCTGGAGCTAGG - Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1159988711 18:74876785-74876807 CGGCTTGTACGGCTGGAGCAGGG - Intronic
1162033102 19:7925756-7925778 CTGCGCGCACGGCCAGAGTTGGG - Intronic
1165851408 19:38852089-38852111 CGGCGCGCACGGCCGGAGCACGG + Intronic
1167614228 19:50523077-50523099 CGCCTCTCAGGGCTGGAGCTGGG + Intronic
925276198 2:2649918-2649940 CAGCTCCCACGGCTGGGTCTAGG - Intergenic
926130794 2:10302434-10302456 CTGCACGCGGGGCTGGGGCTGGG + Intergenic
926326419 2:11788162-11788184 CTGCTGGCACGGCTGCTGCTGGG + Intronic
933317441 2:80732610-80732632 CTTCTCTCACTGCTGTAGCTAGG - Intergenic
937985687 2:127637145-127637167 CTGCTTGCCCTGCTGGAGCTGGG - Intronic
940911958 2:159217050-159217072 CTGCTCACATGGCTTTAGCTGGG + Intronic
942319045 2:174719858-174719880 CTTCTCCTTCGGCTGGAGCTCGG - Intergenic
942458112 2:176151677-176151699 CTCCTCGCACGGAGGGAACTTGG - Exonic
948052391 2:234988502-234988524 CTGCTCCCCTGGCTGGAGCTGGG - Intronic
948780388 2:240318052-240318074 CATCTCGCACGGCAGGAGCAAGG + Intergenic
1171389895 20:24794653-24794675 CTTCACTCAAGGCTGGAGCTGGG - Intergenic
1171456320 20:25274742-25274764 CTGCGGGCAAGGCTGGAGCCAGG + Intronic
1172483749 20:35286781-35286803 CTGCTCGCACGGCTGGAGCTGGG - Exonic
1173452798 20:43180117-43180139 CTGCTCTCTTGGCTTGAGCTGGG + Intronic
1174429220 20:50455923-50455945 CTGCTCCCACAGCTGGAGACAGG - Intergenic
1174467908 20:50731588-50731610 CTGCTCACACGGCGGGACCGAGG - Exonic
1175771753 20:61628530-61628552 CTCCTGGCAGGGCAGGAGCTCGG - Intronic
1178405112 21:32317187-32317209 CTGCTCCCACGTCAGGAGCCTGG + Intronic
1180002454 21:45001545-45001567 CTGCTGCCACGGCTGGATCCAGG - Intergenic
1182428420 22:30286814-30286836 CTACTCGCACAGGTGGACCTTGG - Exonic
1183326996 22:37199652-37199674 CTGCGGGGACGGCTGGAGCGTGG - Intergenic
1183587796 22:38762924-38762946 CTGCTTGCAAGGCTGGCCCTGGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
949852137 3:8430094-8430116 CTGCTCTCAAGCCTGGGGCTGGG - Intergenic
950552573 3:13675569-13675591 CTGCTGGCAGAGCTGGAGGTGGG - Intergenic
953329821 3:42043501-42043523 CTGCTCACAGGGCTGGGGGTAGG - Intronic
953981776 3:47416974-47416996 CTGCTCACAGGTGTGGAGCTGGG + Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
955816294 3:62846953-62846975 CCACTCGCCCGGCTGGAGGTGGG + Intronic
957898494 3:86455273-86455295 CTGCTTGCAAGGCTGGCTCTTGG - Intergenic
960441329 3:117692633-117692655 TTGCTCTCTCTGCTGGAGCTGGG + Intergenic
965520801 3:169666675-169666697 CTGGTCTCACGGCTGGGACTGGG - Intergenic
967979871 3:195059332-195059354 CTGCCCCCTCAGCTGGAGCTGGG - Intergenic
968652258 4:1764915-1764937 CCCCTCGCAGGGCTGGAGGTGGG - Intergenic
971003202 4:22345823-22345845 GTGCCAGCACTGCTGGAGCTAGG + Intronic
980986343 4:139698582-139698604 CTTCTCCTTCGGCTGGAGCTCGG + Intronic
982127804 4:152199526-152199548 CTGCTAGTAAGGGTGGAGCTGGG - Intergenic
985552456 5:540554-540576 CTCATGGCAGGGCTGGAGCTGGG + Intergenic
999824484 5:155260936-155260958 CTGCTTGCACAGCAGGAACTGGG + Intergenic
1001096935 5:168782631-168782653 CTGCTCCCACCCCTGGAGTTGGG + Intronic
1003978167 6:11363981-11364003 CTGCTTGCAAGGCTGGCCCTTGG + Intronic
1006304112 6:33208623-33208645 GAGCGCGAACGGCTGGAGCTGGG + Exonic
1007786971 6:44286177-44286199 CTGGTCGCCCGGCCGGAGCTGGG + Exonic
1012268422 6:97176475-97176497 CTGCTTGCAAGGCTGGCTCTTGG + Intronic
1014105775 6:117558951-117558973 CTGCTTGCAAGGTTGGACCTTGG - Intronic
1019781800 7:2944842-2944864 CTGCCCACAAGGCTGGATCTGGG - Intronic
1021866431 7:24962743-24962765 CTTCAGGCACGGCTGGACCTAGG - Intronic
1024016896 7:45325473-45325495 CTGCTGGCAGGGGTGGAGCCAGG + Intergenic
1025209799 7:57013979-57014001 GTGCTGGCTGGGCTGGAGCTGGG + Intergenic
1025245452 7:57313268-57313290 CTGCTCCCACAGCTGGAGACGGG + Intergenic
1025662154 7:63562872-63562894 GTGCTGGCTGGGCTGGAGCTGGG - Intergenic
1025689617 7:63747419-63747441 CTGCTTGAAAGGCAGGAGCTTGG - Intergenic
1027445198 7:78265924-78265946 CTGCTGGCTGGGGTGGAGCTGGG + Intronic
1033589120 7:142796119-142796141 GTACTGGAACGGCTGGAGCTGGG - Intergenic
1035448886 7:158961774-158961796 CTGCTCTCACCTCTTGAGCTGGG + Intergenic
1037116719 8:15236933-15236955 CTGCTCCCGCGCCTGGGGCTAGG + Intronic
1037361916 8:18083498-18083520 CTGCTCGCACCGCCCAAGCTTGG + Intronic
1042930072 8:74004385-74004407 CTCCTCCCATGGGTGGAGCTAGG + Intronic
1048697956 8:137049781-137049803 CTGCTGGAGCTGCTGGAGCTGGG - Intergenic
1049043450 8:140129990-140130012 CTGATTGCAGGGCTGGAGCAGGG + Intronic
1049158046 8:141078866-141078888 CTGTGAGGACGGCTGGAGCTGGG - Intergenic
1049267376 8:141675853-141675875 CTGCCCCCCCGACTGGAGCTGGG - Intergenic
1049789958 8:144467999-144468021 CTGCAGGAACGGCTGCAGCTCGG - Intronic
1049851959 8:144837417-144837439 CTGATCTCTCGGCTGGAGCAGGG + Exonic
1056842477 9:90009617-90009639 CGGCTCGCAGGGCTTCAGCTGGG + Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1061508050 9:131043258-131043280 CTGGCCGCACTGCTGGAGCTTGG - Intronic
1062337982 9:136080903-136080925 CTACTCGAGCGGCTGGGGCTTGG - Intronic
1185918319 X:4061391-4061413 CTGGTCTCACTGTTGGAGCTGGG - Intergenic
1188314776 X:28659498-28659520 CTTCTCCTTCGGCTGGAGCTCGG + Intronic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1197179032 X:123514420-123514442 CTTCTCCTTCGGCTGGAGCTCGG - Intergenic
1200081571 X:153579359-153579381 CAGCTCCCATGGCTGGAGCCGGG - Intronic