ID: 1172484055

View in Genome Browser
Species Human (GRCh38)
Location 20:35287955-35287977
Sequence CTGCAAAGCCAGGTGAAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 241}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172484045_1172484055 13 Left 1172484045 20:35287919-35287941 CCCCTCAGCTGCAGCACCATGCT 0: 1
1: 0
2: 1
3: 18
4: 246
Right 1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG 0: 1
1: 0
2: 3
3: 33
4: 241
1172484051_1172484055 -3 Left 1172484051 20:35287935-35287957 CCATGCTAGTGTGGGCCTGGCTG 0: 1
1: 0
2: 0
3: 14
4: 181
Right 1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG 0: 1
1: 0
2: 3
3: 33
4: 241
1172484044_1172484055 24 Left 1172484044 20:35287908-35287930 CCACGATGCGGCCCCTCAGCTGC 0: 1
1: 0
2: 0
3: 10
4: 118
Right 1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG 0: 1
1: 0
2: 3
3: 33
4: 241
1172484047_1172484055 11 Left 1172484047 20:35287921-35287943 CCTCAGCTGCAGCACCATGCTAG 0: 1
1: 0
2: 3
3: 25
4: 242
Right 1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG 0: 1
1: 0
2: 3
3: 33
4: 241
1172484046_1172484055 12 Left 1172484046 20:35287920-35287942 CCCTCAGCTGCAGCACCATGCTA 0: 1
1: 0
2: 1
3: 10
4: 172
Right 1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG 0: 1
1: 0
2: 3
3: 33
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172484055 Original CRISPR CTGCAAAGCCAGGTGAAGCT GGG Exonic
901727103 1:11250472-11250494 CTGAGAAGCCAGGTGAAGAAAGG - Intronic
902253252 1:15170305-15170327 CTGCAGGGCAAGGTAAAGCTAGG + Intronic
902536054 1:17119859-17119881 GTGCAAAGCCGGGTGCAGCCCGG + Intergenic
902638647 1:17751660-17751682 CTGAAAAGCTAGGTGAACTTGGG - Intergenic
903870757 1:26432681-26432703 CTGCAAAGCCAGGAGAACCGAGG + Intronic
903871999 1:26442596-26442618 CCCCAAAGCTGGGTGAAGCTAGG - Intronic
906218792 1:44061014-44061036 GGTAAAAGCCAGGTGAAGCTTGG - Intergenic
907798798 1:57743657-57743679 CGGCAGAGTCAGGTGAAGCTCGG - Intronic
907989392 1:59564825-59564847 CGGCAAAGTCAGGTGAAACAAGG + Intronic
908389126 1:63669511-63669533 CTGACAGGCCAGGTGAAGCCAGG - Intergenic
910712254 1:90194019-90194041 CTCCAAGGCTAGGTGAAGCTAGG + Intergenic
912423583 1:109565825-109565847 CTGTAAAGCCAGGTTGAGCCTGG + Intronic
912593510 1:110851213-110851235 ATGGAAAGCCAGGTGAAAGTAGG - Intergenic
916576409 1:166070753-166070775 CTGCTTTGCCAGGTCAAGCTGGG - Exonic
916679420 1:167090431-167090453 CTGCCAATCCAGCTGAGGCTGGG - Exonic
917274616 1:173319007-173319029 CTGGAAAGGCAGCTGAAGCCAGG + Intergenic
917576817 1:176331148-176331170 CTGCAATGCCACGGGAAGTTTGG + Intergenic
918219107 1:182419355-182419377 ATTCAAAGCCAGGTCCAGCTGGG - Intergenic
922287235 1:224181088-224181110 CTGCCAATCCAGATGAAACTTGG + Intronic
922289491 1:224198655-224198677 CTGCCAATCCAGATGAAACTTGG - Intergenic
923640493 1:235754518-235754540 CTGAAAAGACAGGTGAGGCTGGG - Intronic
1062911324 10:1214313-1214335 GTGCAAACCCACGTGACGCTGGG - Intronic
1063421385 10:5915217-5915239 ATTCAAAGCCAGGTGAAGGTGGG - Intronic
1067347031 10:45444275-45444297 CAGGAAAACGAGGTGAAGCTGGG + Exonic
1067781321 10:49209415-49209437 CTGCAAAGCCAGGTAAGGTGTGG + Intergenic
1068482993 10:57618752-57618774 CTGGAAAGCCAGCAAAAGCTGGG + Intergenic
1071103659 10:82068761-82068783 TGGCCAAGCCAGGTCAAGCTGGG + Intronic
1071259811 10:83909538-83909560 CTTCAATGCAAGGTGAAGTTGGG - Intergenic
1072089245 10:92110947-92110969 CTGCATAGCAAGGCCAAGCTGGG + Intronic
1073329414 10:102660944-102660966 CTACAAAGCCAGGGACAGCTGGG - Intergenic
1074055807 10:109922500-109922522 CGGCAAATCCAGGTCAAGGTAGG + Intronic
1075766667 10:124898798-124898820 CAGCAAAGCTAGGTGGAACTGGG + Intergenic
1077392658 11:2307235-2307257 CTGGCATGCCAGGGGAAGCTGGG - Intronic
1077427551 11:2490553-2490575 ATGCTAAGCCACCTGAAGCTTGG - Intronic
1078083024 11:8217688-8217710 CTGAAAGCCCAGGTGAAGCAGGG + Intergenic
1078876407 11:15403169-15403191 GGGCAAAGCCAGGTGGGGCTGGG + Intergenic
1078936997 11:15960813-15960835 GTGCAAGGCCATGTGAAGATGGG + Intergenic
1080177853 11:29388322-29388344 TTGCAATCTCAGGTGAAGCTTGG - Intergenic
1080179405 11:29405874-29405896 CTGCAAATCTAGTTGAAACTGGG + Intergenic
1080458323 11:32434479-32434501 CTCCAAAGCCAGGCAGAGCTAGG - Intronic
1080965645 11:37211090-37211112 CTGGAAAGCGAGCTGAAGCCAGG - Intergenic
1081317749 11:41651060-41651082 CTGCAAAGGGGGGTGAAGCCAGG - Intergenic
1083131868 11:60632470-60632492 GGGCAAAGCCAGGTGAGGGTTGG - Intergenic
1083161826 11:60859029-60859051 CAGCAATGCCAGGGGAGGCTTGG - Intergenic
1083840158 11:65299630-65299652 CAGCAAGGCCAGGTTGAGCTGGG - Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1084758757 11:71255015-71255037 CTGCAAAACCTGGTGAATCCTGG - Intergenic
1084769658 11:71334436-71334458 CAGCAAAGCCTGGGGAGGCTGGG - Intergenic
1084975079 11:72792617-72792639 CTCCCCAGCCAGGTGAAGCGAGG - Intronic
1085044999 11:73347550-73347572 TTGCAAAGCCAAGTGAGGCCTGG + Intronic
1085054926 11:73397940-73397962 CTGCAAGGCCAGGTGCTGCTGGG + Intergenic
1085867569 11:80312584-80312606 GTGGAAAGCCAGGGAAAGCTAGG + Intergenic
1086907337 11:92433210-92433232 CTGGAAAGGCAGCTGAAGCCAGG - Intronic
1087774135 11:102242441-102242463 CTGAAAAGTCAGCTGAGGCTGGG + Intergenic
1089180251 11:116578667-116578689 CCACAGAGCCAGGTGAAGCCAGG - Intergenic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1099486268 12:83232787-83232809 CTGGAAAGGCAGCTGAAGCCAGG - Intergenic
1101005448 12:100397106-100397128 CTGAAGAGGCTGGTGAAGCTAGG - Intronic
1101049001 12:100841490-100841512 CTACAAAGAAAGATGAAGCTGGG + Intronic
1101963665 12:109267725-109267747 CTGCAGAGCCAGGAGCTGCTGGG - Exonic
1104856470 12:131904655-131904677 CAGCAAAGCCAGGACAAGCAGGG - Intronic
1110337258 13:74346748-74346770 CTGGAAAGACAGCTGAAGCCAGG + Intergenic
1111008451 13:82281114-82281136 CTGCTAAGCCAGATGGACCTTGG + Intergenic
1112306629 13:98280283-98280305 CTGGAAAACCAGCTGATGCTGGG - Intronic
1113768792 13:112895800-112895822 CTGCACAGCCCGGTGAAGTTGGG - Intronic
1116356637 14:43938712-43938734 CTGTAGAGCCAGCGGAAGCTGGG + Intergenic
1117772784 14:59151565-59151587 CTGCAAACCCAGGAGAAACAAGG - Intergenic
1121098503 14:91234004-91234026 CTGGAAGGCCGGGTGGAGCTTGG + Exonic
1121529425 14:94641813-94641835 CAGCAGACCCAGGGGAAGCTCGG + Intergenic
1121573025 14:94961829-94961851 TTGCACAGCCAGCTGAGGCTTGG - Intergenic
1121674283 14:95739791-95739813 GCGCAAAGCCAGTTGAAGCTCGG + Intergenic
1122398431 14:101451607-101451629 CTTCAAACCCAGGGGATGCTGGG + Intergenic
1122474374 14:101996466-101996488 ATACAAAGCAAGGTGGAGCTGGG - Intronic
1122804305 14:104248865-104248887 CGGCAAGGCCAGGTCAAGCCAGG - Intergenic
1128942931 15:71802992-71803014 CTGCAAGGCAAGGCGAAGATGGG + Intronic
1130342899 15:83014108-83014130 CTGGAAACCTAGGTGTAGCTGGG + Intergenic
1132142499 15:99407272-99407294 CTGCAAAGCCAGGTGCAGCAGGG + Intergenic
1133015027 16:2935758-2935780 CAGCACAGCCAGGTACAGCTGGG - Intronic
1133026369 16:2990576-2990598 CAGCCCAGCCAGGTGAGGCTGGG + Intergenic
1133335317 16:5003363-5003385 CAGCAGAGCCAGGTGGAGCTGGG + Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134569264 16:15277649-15277671 CTCCAAAGCCATGTGGAACTGGG - Intergenic
1134733113 16:16478396-16478418 CTCCAAAGCCATGTGGAACTGGG + Intergenic
1134934326 16:18233577-18233599 CTCCAAAGCCATGTGGAACTGGG - Intergenic
1135712267 16:24728151-24728173 TTGTAAAGCCAGTTGAAGCTGGG + Intergenic
1136155590 16:28380061-28380083 CTGCAGAGCCAGGTTCTGCTGGG + Exonic
1136207494 16:28735228-28735250 CTGCAGAGCCAGGTTCTGCTGGG - Exonic
1136275390 16:29176759-29176781 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1137571158 16:49567248-49567270 CATCAAAGCCAGCTAAAGCTGGG - Intronic
1138785312 16:59838710-59838732 CTACAAGGCCAGGTAAAGCCAGG + Intergenic
1139747638 16:69087331-69087353 CTGAAAAAGCAGTTGAAGCTTGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141615559 16:85207622-85207644 CTGCAGAGCCAGATGAGGCTGGG + Intergenic
1142079750 16:88142824-88142846 CTGCACATCCAGGTGGGGCTGGG - Intergenic
1143977968 17:10844377-10844399 ATGCAAAGCCAGGGGAAGTAAGG + Intergenic
1146055170 17:29577370-29577392 CTGACTAGCCAGGTGAAGCTAGG - Intronic
1146279507 17:31536112-31536134 CAGCAGGGCCAGGTGAAACTGGG + Exonic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146728859 17:35177018-35177040 CTCCAAAGCCAGGGGAATCAGGG - Exonic
1149550775 17:57537830-57537852 TTGCAAAGCCAGGGGGAGTTTGG + Intronic
1149889915 17:60378960-60378982 TGGCAAAGCCAGGAGAAGGTGGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1150640702 17:66947632-66947654 ATGCAAAGCCAGCTGCAGCCTGG + Intergenic
1151517148 17:74604007-74604029 CTGCTGTCCCAGGTGAAGCTGGG - Intergenic
1151589523 17:75034235-75034257 CTGCCCCGCCAGGTGGAGCTGGG - Intronic
1152197970 17:78928628-78928650 CTGCAAAGTCAGATGAAGAGGGG + Intergenic
1152489096 17:80616946-80616968 CTGCGCAGTCAGCTGAAGCTTGG - Intronic
1152614531 17:81331652-81331674 CGGCAAAGCCAGGGGACGCCAGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1157097711 18:44701427-44701449 CTGCACAGCCAGGAGCAGCTGGG - Exonic
1157332343 18:46713043-46713065 GAGCAAAGCCAAGTCAAGCTGGG + Intronic
1159679808 18:71335039-71335061 CCCCAAAGCCAGTTGAACCTAGG - Intergenic
1161070451 19:2257288-2257310 CTGCAAAGCATGGTGACTCTGGG + Intronic
1161091748 19:2363682-2363704 CAGCTAAGCCAGGTGAGCCTGGG - Intergenic
1161846278 19:6713566-6713588 CAGCACAGGCAGGAGAAGCTGGG - Intronic
1162105191 19:8366053-8366075 CTGCAAAGCCAGGTAACCCTAGG + Exonic
1162468687 19:10858888-10858910 GCCCACAGCCAGGTGAAGCTGGG - Intronic
1164157082 19:22603448-22603470 CAGCAAAGCCAGGAGAAGGGGGG + Intergenic
1164544303 19:29146410-29146432 CAACAAAGCCAGCTCAAGCTTGG + Intergenic
1164644684 19:29849778-29849800 CCTCAAAGCCAGGTGGGGCTGGG - Intergenic
1165399555 19:35589256-35589278 CTGCAAAGCCATGTCAGGTTAGG + Intergenic
1165768027 19:38362728-38362750 CTGCATAGCCAGGTGGACGTGGG + Exonic
1166902839 19:46079413-46079435 CTGCAAAACCAGGTGCACCATGG - Intergenic
1167033563 19:46979323-46979345 ATTCAAAGCCAGGAGCAGCTGGG - Intronic
1168345748 19:55649459-55649481 CTCCAGAGCCATGTGCAGCTGGG - Exonic
926230888 2:11003031-11003053 CTGCAAAGGCAGGGGAGACTGGG + Intergenic
927433475 2:23047209-23047231 AGGCAAAGCCAGGTGAACTTGGG - Intergenic
929921100 2:46172178-46172200 CTGCAAAGCCAGGCTGAGCTGGG + Intronic
930692434 2:54378317-54378339 CTGCAAAGCCGTGTGAGGCTGGG - Intronic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
932105217 2:68935906-68935928 CTGCAAAGCAAGTTGAAGTCTGG + Intergenic
932974623 2:76583984-76584006 CTGCAAAGCCATCTGATCCTGGG + Intergenic
933368074 2:81380027-81380049 GTGGAAAACCAGTTGAAGCTTGG + Intergenic
933560573 2:83880518-83880540 CTGCATACCCAGGTGCATCTTGG - Intergenic
934928261 2:98397163-98397185 CTGGAAAGCCAGGTGAAGGGTGG + Exonic
936514776 2:113174606-113174628 CTGGAAGGCAAGATGAAGCTGGG - Intronic
937279078 2:120705061-120705083 CTCCAAATGCAGGTGAACCTTGG - Intergenic
938028262 2:127969685-127969707 CAGCAAAGCCACCAGAAGCTGGG - Intronic
938563083 2:132491778-132491800 CAGCAAGGACATGTGAAGCTAGG - Intronic
938729238 2:134133446-134133468 CTGAAATGCCAGGTGAAGGATGG + Intronic
939566382 2:143790772-143790794 CTCCTGAGCTAGGTGAAGCTGGG + Intergenic
941983246 2:171483354-171483376 ATGCAAGCCCAGGTGAAGCAGGG + Exonic
943499332 2:188666901-188666923 CTGCCAAGGCAGCTGAAACTTGG - Intergenic
944169581 2:196759992-196760014 CTCCAAAGACAGGTGAAGTGTGG - Intronic
945395250 2:209307889-209307911 CTGCAGAGCCAGCAGGAGCTGGG - Intergenic
945472264 2:210240552-210240574 CTGCAAAACCACCAGAAGCTAGG + Intergenic
946689201 2:222298316-222298338 CTGCAAATCCTGGCGGAGCTGGG - Exonic
947049453 2:226025456-226025478 TAGCAAAGTCAAGTGAAGCTGGG + Intergenic
947588476 2:231371102-231371124 CAGCAAATCCAGGGGAGGCTCGG + Intronic
948242007 2:236445967-236445989 GTGCAAAGCCAGGGGACCCTGGG - Intronic
948761909 2:240197504-240197526 CTGCAGCCCCAGGTCAAGCTAGG + Intergenic
1169192362 20:3666465-3666487 CAGCACAGCCAGGTGATCCTGGG + Intergenic
1170221424 20:13946590-13946612 CCGCAGAGCCAGTGGAAGCTGGG + Intronic
1171257226 20:23698581-23698603 CTGCAAAGGGAGGTGCAGGTAGG + Intergenic
1171264590 20:23760435-23760457 CTGCAAAGGGAGGTGCAGGTAGG + Intergenic
1171274367 20:23843069-23843091 CTGCAAAGAGAGGTGCAGGTAGG + Intergenic
1172144065 20:32743987-32744009 CGGCAATACCAGGTGATGCTGGG - Exonic
1172484055 20:35287955-35287977 CTGCAAAGCCAGGTGAAGCTGGG + Exonic
1172798411 20:37559286-37559308 CTGCAACTCCAGAGGAAGCTAGG - Intergenic
1172848776 20:37945470-37945492 CTGCAAAGCCAGGCGCTGCTTGG - Intergenic
1173274143 20:41564792-41564814 CAGCAAAGGCAGGTGAAGTTTGG + Intronic
1173878696 20:46394160-46394182 CTGCCAAGCAGGGTCAAGCTGGG + Intronic
1174037244 20:47675769-47675791 CTGGAAAGCCAGGGCAGGCTTGG - Intronic
1174291163 20:49509626-49509648 CTGCACACCCAGGTTCAGCTGGG - Intronic
1174453593 20:50634616-50634638 CTGCACAGCCTGGTGAAGTAGGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175053242 20:56174373-56174395 CTGCCTAGCCAGGTGACTCTCGG + Intergenic
1175245285 20:57578591-57578613 CTGAAGAGCCAGGAGAAGCGAGG + Intergenic
1175314895 20:58040332-58040354 CTGCTAAGGCAGGTGAGGGTGGG - Intergenic
1176137436 20:63530407-63530429 CTGCAATCCCAGGGGAAGTTGGG - Intronic
1177688951 21:24478167-24478189 CTGCAATGCCAGATGGTGCTTGG - Intergenic
1177771911 21:25526442-25526464 CTGCAAAGTCAAGTGCAGCAGGG - Intergenic
1177971844 21:27799516-27799538 ATGAAATGCCAGGTGAAGTTTGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182663662 22:31942764-31942786 CTTCAAAGCATGGTGAAGCCTGG + Intronic
1184556466 22:45235905-45235927 TTGCTAGGCCAGGTGTAGCTGGG - Intronic
1185069424 22:48647985-48648007 CTGCAAAGCCAGAAGAAGATAGG + Intronic
1185388114 22:50545812-50545834 CTGCCAAGCCCCCTGAAGCTGGG + Intergenic
951623943 3:24639445-24639467 CTGGAGAGACAGGTGAATCTAGG - Intergenic
953004714 3:38967596-38967618 CAGAAAAGCCAAGTGAAGCAAGG + Intergenic
953005738 3:38977636-38977658 CTGGAAAGGCAGGTGAAGGTAGG - Intergenic
954580931 3:51702571-51702593 GAGCCAAGCCAGGTGCAGCTGGG - Intronic
954903264 3:54038545-54038567 CTGCAAAGCCAGGTCAAGTTAGG + Intergenic
955035480 3:55263185-55263207 GTGCAAAGACAGATGAATCTTGG + Intergenic
956000501 3:64724939-64724961 ATGCAAAGACAGGAGAAGATGGG - Intergenic
956052671 3:65265343-65265365 CTGCAAACGCAGGTCAGGCTTGG + Intergenic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
957814275 3:85272856-85272878 CTGCAATGAAAGGTGAAGCAGGG - Intronic
962196222 3:133365840-133365862 CTCCAAGGTCTGGTGAAGCTAGG + Intronic
962617062 3:137136960-137136982 TTGAAAAGCAAGGGGAAGCTGGG + Intergenic
965608048 3:170516068-170516090 CAGCAAAGCCAGGAAAACCTGGG - Intronic
967776960 3:193395018-193395040 CTGCAAAGCCACAGGGAGCTTGG - Intergenic
967935214 3:194722133-194722155 GTGCAAAGCCAGGTGACCCTTGG + Intergenic
968319306 3:197750811-197750833 CTGAGAAGCCAGGTAAAGCGTGG + Intronic
969574867 4:8030878-8030900 CTGCAGAGCCAGCAGCAGCTGGG - Intronic
970186280 4:13457182-13457204 ATGGAAAGACATGTGAAGCTGGG - Intronic
973849684 4:54948680-54948702 CAGCAAAGCCAGGTATTGCTGGG + Intergenic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974004038 4:56537986-56538008 GTAGAAATCCAGGTGAAGCTAGG - Intronic
976080037 4:81345678-81345700 CTGCAAAGGGAGGAGTAGCTGGG + Intergenic
979980404 4:127247858-127247880 GTGCAAGTCCAGGTGAAGCCTGG + Intergenic
980719463 4:136675435-136675457 CTGCCAAGGCAGTTAAAGCTTGG - Intergenic
982533122 4:156572431-156572453 CTTCCAAGCCAGGTGAAAGTGGG + Intergenic
983301501 4:165931991-165932013 CTGGAAAGCCAGGTGATGGTTGG + Intronic
985358583 4:189147474-189147496 CTGCAAAGCCATGTCAAGTGTGG + Intergenic
985622043 5:960861-960883 CTGAGAAGACAGCTGAAGCTTGG - Intergenic
985649111 5:1099133-1099155 CTGCCAAGCAGGGTGAAGCGGGG + Intronic
986118084 5:4800485-4800507 CTGTGAAGGCAGGTGGAGCTGGG + Intergenic
986169219 5:5302150-5302172 GTGCAAAACCAGCTGAGGCTTGG + Intronic
986378851 5:7162780-7162802 CTGGAAAGGGAGCTGAAGCTAGG - Intergenic
986980608 5:13444090-13444112 CTGCAAAGCCTGCTGTAGCAGGG - Intergenic
987328272 5:16832224-16832246 CTACAAAGCCAGGTGCAGTGGGG - Intronic
990269458 5:54119859-54119881 CTGCAAGATCAGGTAAAGCTTGG - Intronic
992485415 5:77189833-77189855 GAGGGAAGCCAGGTGAAGCTAGG + Intergenic
993982037 5:94554185-94554207 CTGCCAAGTCAGGGGAACCTGGG - Intronic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995727216 5:115193883-115193905 CTGCTGGGGCAGGTGAAGCTTGG + Intergenic
997580029 5:135011380-135011402 CTTCAGAGCCAGATGAGGCTGGG - Intronic
998099005 5:139416507-139416529 GTGCAAAGCCAGGTAAAGCCAGG + Intronic
998399794 5:141842796-141842818 CCCCAAAGCCCTGTGAAGCTTGG - Intergenic
999888750 5:155953462-155953484 CTGCAAAGCCTGGAAAAGTTTGG + Intronic
1000379106 5:160612985-160613007 CCCCAAAGCCATGTGAAGCCAGG + Intronic
1001050644 5:168411360-168411382 CAGCCAGGCCAGGTGAAGCATGG + Intronic
1001100286 5:168808728-168808750 CTGCAAAGAGAGGTGGAGCAGGG - Intronic
1002362346 5:178682484-178682506 CTGAAAAGACAAGTGCAGCTGGG + Intergenic
1004109486 6:12701656-12701678 CTGCAAAGCCATGTAAAACATGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005378257 6:25207397-25207419 CTGGAAAGGCAGCTGAAGCCAGG + Intergenic
1006743766 6:36326948-36326970 CTGCAAGGACAGGTGGAGCTTGG + Intronic
1006913173 6:37577444-37577466 CTACAAAGCCCCCTGAAGCTGGG + Intergenic
1007161340 6:39793655-39793677 TTGCAAAGCCAGCTGAAGCGGGG + Intronic
1007412665 6:41673950-41673972 CTGCAGAGCCAGGAGAAGGGAGG + Intergenic
1013332759 6:109122252-109122274 CTGCAAAGCTAGGTGAATACTGG + Intronic
1014820811 6:125986696-125986718 CTGCATAGCCCGAGGAAGCTGGG + Intronic
1014971665 6:127824050-127824072 CTGGAAAGCAAGGTGAAGCCAGG + Intronic
1016523886 6:144977529-144977551 CTGCCAAGCCAGGTGCAGGAGGG + Intergenic
1017788276 6:157774163-157774185 CTGCCAAGCCCAGTGCAGCTTGG - Intronic
1019436779 7:1026277-1026299 CAGCAATGCCAGGTGCAGCTGGG - Intronic
1019770461 7:2881020-2881042 GGGCAAGGCCAGGAGAAGCTGGG - Intergenic
1019889001 7:3930319-3930341 CTCCACACCCAGGTGAAGCCAGG - Intronic
1021103444 7:16609731-16609753 CTGGAAAGCCATCAGAAGCTCGG + Exonic
1022603547 7:31785320-31785342 CTGCTCAGCCAGGAGAAGCAGGG - Intronic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026901308 7:74038901-74038923 CTGCAAGGCCAGGAGACCCTGGG + Intronic
1028088866 7:86672480-86672502 TTGCAAAGAGAGGGGAAGCTAGG - Intronic
1028124708 7:87099388-87099410 CTTCAAAACCAGCTGAGGCTAGG - Intergenic
1028778724 7:94709753-94709775 CTGCAAAGCCAGTTGAATTTCGG - Intergenic
1029106240 7:98178907-98178929 CTGCAAGACCATGTGATGCTGGG - Intronic
1032451385 7:132034893-132034915 CTGCAGAGCCAGGTGGGGTTGGG - Intergenic
1033241575 7:139683926-139683948 CTGCAAAGCTCAGTCAAGCTAGG - Intronic
1035746692 8:1966248-1966270 CCACAGAGCCAGGTGGAGCTGGG + Intergenic
1039445211 8:37625728-37625750 CTGAAAGGCCAGGTAAAGTTGGG - Intergenic
1040937468 8:52796257-52796279 CTGGAAAGCCAGGTGAAGAAAGG - Intergenic
1041396726 8:57399228-57399250 CTCCAAAGTCAGGTGCAGGTGGG - Intergenic
1042872748 8:73413038-73413060 CTGGGGAGCCAGGGGAAGCTGGG - Intergenic
1045239259 8:100384602-100384624 CTGCAGAGCCTGGGGAAGCCTGG - Intronic
1047184404 8:122618964-122618986 CTGCTGAGCCAGGTGAACCATGG + Intergenic
1049160799 8:141096299-141096321 AGGCAAATCCAAGTGAAGCTGGG - Intergenic
1051609233 9:18945249-18945271 CTGGAAAACAAGGTGATGCTTGG - Intronic
1052342235 9:27375124-27375146 TTGTAAGGCCAGGTGAGGCTTGG + Intronic
1060089893 9:120733334-120733356 CTGCAAAGGCAGTTGAGGCGGGG + Intergenic
1060278193 9:122198077-122198099 CTGCAGAGCCTGGTGAACCTTGG + Intronic
1061038204 9:128125162-128125184 CTGCAGAGCCAGGCCAGGCTAGG + Intronic
1061060997 9:128250532-128250554 CTGCAAGGCTGGGTGGAGCTGGG + Intronic
1061515156 9:131085501-131085523 CTGCAAACCCGGCTGAGGCTGGG - Intronic
1062115248 9:134805138-134805160 CTGCAAAGCCATGAAAAGGTTGG - Intronic
1062721290 9:138045612-138045634 CTGCAAAGCCTGGGGTGGCTGGG + Intronic
1185816633 X:3162603-3162625 GTGCAAAATCAGGTGAAGTTTGG - Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1187018835 X:15358586-15358608 CTTTAAAGCCAGGTGTAGGTAGG + Intronic
1188756390 X:33968924-33968946 CTGCAGAGCCAGTGGGAGCTGGG + Intergenic
1195656508 X:107336526-107336548 CTGCAAGCCCAGCTGAAGTTAGG + Intergenic
1200761372 Y:7042278-7042300 CTGCAAAGTCATGTGAACCATGG + Intronic
1201354471 Y:13082779-13082801 CAGCAAAGCCTGGTGGAGCTGGG - Intergenic
1201647348 Y:16250004-16250026 CTGCAAAGCCATTTGGTGCTGGG - Intergenic
1201655463 Y:16335297-16335319 CTGCAAAGCCATTTGGTGCTGGG + Intergenic