ID: 1172487565

View in Genome Browser
Species Human (GRCh38)
Location 20:35307514-35307536
Sequence TTGGACCTCTAGAGGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 200}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172487556_1172487565 7 Left 1172487556 20:35307484-35307506 CCCAGCCACCAGCTAAGGACATT 0: 1
1: 0
2: 2
3: 12
4: 142
Right 1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG 0: 1
1: 0
2: 4
3: 21
4: 200
1172487558_1172487565 2 Left 1172487558 20:35307489-35307511 CCACCAGCTAAGGACATTTTCTA 0: 1
1: 0
2: 2
3: 19
4: 173
Right 1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG 0: 1
1: 0
2: 4
3: 21
4: 200
1172487557_1172487565 6 Left 1172487557 20:35307485-35307507 CCAGCCACCAGCTAAGGACATTT 0: 1
1: 0
2: 3
3: 35
4: 162
Right 1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG 0: 1
1: 0
2: 4
3: 21
4: 200
1172487559_1172487565 -1 Left 1172487559 20:35307492-35307514 CCAGCTAAGGACATTTTCTAGCT 0: 1
1: 1
2: 3
3: 13
4: 211
Right 1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG 0: 1
1: 0
2: 4
3: 21
4: 200
1172487555_1172487565 8 Left 1172487555 20:35307483-35307505 CCCCAGCCACCAGCTAAGGACAT 0: 1
1: 0
2: 1
3: 20
4: 188
Right 1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG 0: 1
1: 0
2: 4
3: 21
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172487565 Original CRISPR TTGGACCTCTAGAGGAGGGA GGG Intronic
902398790 1:16146333-16146355 CCCCACCTCTAGAGGAGGGAAGG + Intronic
902782517 1:18713706-18713728 GAGGAAGTCTAGAGGAGGGAGGG + Intronic
904490877 1:30858335-30858357 GTGGACCTTTTGAGCAGGGAGGG - Intergenic
904580060 1:31536372-31536394 CTGGACCTCTACAGAAGAGAGGG + Intergenic
904622010 1:31781424-31781446 CTGCACGTCCAGAGGAGGGAGGG + Intergenic
905543571 1:38779757-38779779 ATTGACGTCTAGAGAAGGGAAGG - Intergenic
906745958 1:48222390-48222412 TTGGAACCCCAGAGGTGGGAAGG - Intergenic
906799128 1:48720862-48720884 TTGGAAAACTAGAGAAGGGAGGG + Intronic
906979569 1:50615039-50615061 GTGGACTACTAGAGCAGGGAGGG - Intronic
908360977 1:63367943-63367965 CTGGCCCTCAAGAGGAGGGGCGG + Intronic
908625055 1:66030948-66030970 GGGGACCACTAGAAGAGGGAGGG + Intronic
911545047 1:99206377-99206399 GTGGACTACTAGAGAAGGGAGGG - Intergenic
914802353 1:150970961-150970983 TTGGATACCCAGAGGAGGGAGGG + Intronic
916339745 1:163718682-163718704 ATGGACTCCTAGAGGATGGAGGG + Intergenic
916907366 1:169301907-169301929 GTGGACTACTAGAGGAGAGAAGG + Intronic
917384981 1:174462685-174462707 GGGGACCACTAGAGGAAGGAGGG - Intronic
917593885 1:176507771-176507793 GTGGACTACTAGAGGAGGGAGGG + Intronic
919106033 1:193151841-193151863 TTGAACCTGTGGAGGGGGGATGG + Intronic
920280162 1:204837266-204837288 TTGGGCCTCTAGAGATGGGTAGG + Intronic
920301094 1:204989542-204989564 TGGGACCTCTCGAGGAGGCAAGG + Intronic
923101273 1:230819716-230819738 TTGGAGCCCAAGAAGAGGGAGGG - Intergenic
923836734 1:237618966-237618988 TTGGACATCTGGAGGAGGGAAGG - Intronic
1063129024 10:3161630-3161652 TTGAACCTCTGGAGCAGGGAGGG + Intronic
1067056535 10:43055908-43055930 TTGGACCCCTAGAGTAGGAGCGG - Intergenic
1067570037 10:47365010-47365032 TTCCACATCTAGAAGAGGGAAGG - Intergenic
1070537308 10:77389403-77389425 TTCTACCTCTGGAGGAGGGATGG + Intronic
1072428703 10:95352446-95352468 TTGCACCCCTAAAGGAGGGTGGG + Intronic
1072901569 10:99412201-99412223 CAGGACCTCTAGTGGAGTGAGGG + Intronic
1072935440 10:99708055-99708077 GTGGACTACTAGAGCAGGGAGGG - Intronic
1073008480 10:100342165-100342187 ATGGGCCTCCAGAGGAGGGAGGG + Intergenic
1073018700 10:100422947-100422969 GGGGACTACTAGAGGAGGGAGGG - Intergenic
1073019076 10:100426015-100426037 GGGGACTACTAGAGGAGGGAGGG + Intergenic
1074538421 10:114345396-114345418 TGGGTCCTCAAGAGGATGGATGG + Intronic
1078011721 11:7577477-7577499 TTGGAGTTCTTGAGGGGGGAGGG + Intronic
1079244295 11:18741704-18741726 GGGGACTACTAGAGGAGGGAGGG + Intronic
1079481558 11:20886093-20886115 GTGGACTACTAGAGGTGGGAGGG + Intronic
1080095447 11:28400584-28400606 TTGGACCTCAAGAGGGGTGAGGG - Intergenic
1081431925 11:42985858-42985880 GTGGACTACTAGAGGATGGAGGG + Intergenic
1083294099 11:61705999-61706021 TGGGATCTCTGGAGGAGGGAAGG + Intronic
1084172637 11:67407977-67407999 TTAGACCTCGAGAGCAGGGCTGG + Intronic
1085897368 11:80656032-80656054 TAGGACCACTGGGGGAGGGAGGG - Intergenic
1086486643 11:87310466-87310488 GGGGGCTTCTAGAGGAGGGAGGG + Intronic
1087548407 11:99614398-99614420 TTGCACCACGAGTGGAGGGATGG + Intronic
1088107442 11:106223108-106223130 TTGAGCCTCTAGAGAAAGGAAGG + Intergenic
1088652636 11:111971958-111971980 GGGGACTACTAGAGGAGGGAGGG + Intronic
1089523069 11:119078548-119078570 TTTGACCTGGAGAGGAAGGAGGG - Exonic
1090634735 11:128683867-128683889 GTGGAACTCTGGGGGAGGGATGG + Intergenic
1090705118 11:129329308-129329330 CTGGAGCTCTGGAGGAGAGATGG - Intergenic
1094205079 12:27831274-27831296 GTGGACTTCTTGAGGAGGTAAGG - Intergenic
1099103943 12:78477799-78477821 TTAAACCTCTAGAGAAGGGAAGG + Intergenic
1099625893 12:85073134-85073156 ATGGATTTCTAGAGGAGGTATGG + Intronic
1101821006 12:108184264-108184286 TTGAACCTGTAGAGGTGGGCTGG + Intronic
1103343222 12:120232377-120232399 TGGGACCTCTGGAGGAGGGAGGG - Intronic
1103535296 12:121629765-121629787 TTGGAAATCTATAGGAGGGATGG + Intronic
1105051069 12:133051577-133051599 TTTGACCCTTACAGGAGGGAGGG - Intronic
1105629879 13:22152556-22152578 TTGTCCCTCTAGGAGAGGGAGGG - Intergenic
1107103792 13:36622469-36622491 TGGGGCCACTAGAGAAGGGATGG + Intergenic
1108590279 13:51906775-51906797 TTGTACTTCTAGAGGAGAGTTGG - Intergenic
1109561443 13:64054387-64054409 TGGGACCTTAAGAGGAGAGAAGG - Intergenic
1112871578 13:103977559-103977581 ATGAACTACTAGAGGAGGGAAGG + Intergenic
1113843283 13:113371897-113371919 GGGGACCTCAGGAGGAGGGAGGG - Intergenic
1115781198 14:36770357-36770379 GGGGACTTCTAGAGGTGGGAGGG + Intronic
1116370914 14:44130591-44130613 GTGCATGTCTAGAGGAGGGAGGG + Intergenic
1116755884 14:48947438-48947460 TTGAACCTCTAGATGAGAAAAGG + Intergenic
1118914472 14:70090966-70090988 ATGGACCTTTAGAGGATTGATGG - Intronic
1121742424 14:96263693-96263715 TTGGAGCTCTAGAGGGGGCCAGG - Exonic
1123811676 15:23932745-23932767 TTGGATCTCAGGAGGAGGGAGGG + Intergenic
1125391959 15:39202215-39202237 GTGGACTACTAGAGAAGGGAGGG + Intergenic
1128679227 15:69635743-69635765 TTGGACCCATTAAGGAGGGAAGG + Intergenic
1128925309 15:71649961-71649983 TCTGACATCCAGAGGAGGGACGG + Intronic
1129976852 15:79829893-79829915 ATTGACCTCCACAGGAGGGAAGG - Intergenic
1131035259 15:89217922-89217944 TTGGACAGCATGAGGAGGGAAGG + Intronic
1132289905 15:100692678-100692700 TTTGACCCTTAGAGGAGGAATGG - Intergenic
1132764957 16:1529620-1529642 CTGGAGCTCTAGAGGACCGAGGG - Intronic
1133547828 16:6825267-6825289 TTTGGCATCTAGAGTAGGGAAGG - Intronic
1134008724 16:10835462-10835484 TTGGACCTCTAGAAGTGGCCAGG - Intergenic
1135228182 16:20679895-20679917 TAGGCCCTTTACAGGAGGGAGGG - Intronic
1135497543 16:22965615-22965637 TTAGTGCTCCAGAGGAGGGATGG - Intergenic
1137393030 16:48097374-48097396 TTGTGACTGTAGAGGAGGGAAGG + Intronic
1140557456 16:75938090-75938112 TGGGAACTCTAGAGGAAGGGAGG - Intergenic
1140610392 16:76591962-76591984 TGGGACCTGTTGATGAGGGAGGG + Intronic
1142228667 16:88889297-88889319 ATGGAGCGATAGAGGAGGGAGGG + Intronic
1142313140 16:89325845-89325867 TTGGCCTCCTAGAGGAAGGAGGG + Intronic
1143745572 17:8991735-8991757 TTGCTCCTCCAGAGGAGAGAGGG + Intergenic
1144613547 17:16746899-16746921 TGGGACCTAGAGGGGAGGGAGGG - Intronic
1145133208 17:20376946-20376968 TGGGACCTAGAGGGGAGGGAGGG - Intergenic
1145243284 17:21251983-21252005 TGGGACCTCCTGAGGGGGGATGG + Intronic
1147233335 17:39036153-39036175 TTCTAGCTCTAGAGGAGAGATGG + Intergenic
1152501298 17:80711296-80711318 TTGACCCTCCAGAGGATGGAAGG + Intronic
1152847941 17:82614072-82614094 GGGCACCTCTGGAGGAGGGAGGG - Intronic
1153232026 18:2947373-2947395 TTGTCCTTCTAGAGGATGGATGG - Intronic
1153964500 18:10167506-10167528 CTGGACCTCAGGAGGAGGAAGGG + Intergenic
1155108461 18:22690038-22690060 TTGTAACTCTGGGGGAGGGAGGG - Intergenic
1155226211 18:23731756-23731778 GGGGACTACTAGAGGAGGGAGGG + Intronic
1157199044 18:45643358-45643380 ATGTACCTCTAGGAGAGGGAGGG + Intronic
1157307717 18:46529127-46529149 CTGGGCCTGGAGAGGAGGGAAGG + Intronic
1157349123 18:46869265-46869287 TTAAGCCTCTAGAGAAGGGAAGG + Intronic
1157897918 18:51486132-51486154 ATGGAACTCTAGAGGAGGGATGG + Intergenic
1159206971 18:65265434-65265456 TTGGGGGTCTAGGGGAGGGAGGG + Intergenic
1160732179 19:646287-646309 TTGGAGCTGGAGAGGAGGGCTGG - Intergenic
1167244283 19:48364435-48364457 TTGGCCCTCCAGAGAAGGGGCGG + Exonic
925322513 2:2985424-2985446 AGGGACTACTAGAGGAGGGAGGG + Intergenic
925457981 2:4033851-4033873 TAGGACTGCTAGAGGTGGGAGGG + Intergenic
928093661 2:28391579-28391601 TTGGAGCTCCAGAGCAGAGAAGG + Intergenic
928400931 2:30978212-30978234 TTGGGCAGCTGGAGGAGGGAAGG - Intronic
929456835 2:42072291-42072313 CTGGACCTCTAGGGAAGGGCAGG - Intergenic
929925896 2:46208313-46208335 GTGGACTACTAGAGGTGGGAGGG - Intergenic
929975513 2:46630521-46630543 GAGGACTACTAGAGGAGGGAGGG - Intergenic
935184845 2:100722747-100722769 ATGGATTTCTGGAGGAGGGATGG - Intergenic
937092928 2:119218446-119218468 TTGGCCTTCAAGGGGAGGGAAGG - Intergenic
938757210 2:134391850-134391872 TTGGGCCTCTCCAGGAGGGAGGG + Intronic
939541981 2:143505267-143505289 TGGGACCTCTTATGGAGGGAGGG - Intronic
939864017 2:147452564-147452586 TTAAACCTTTAGAGGAAGGAAGG + Intergenic
940738788 2:157483015-157483037 GTGGAACCCTAGAAGAGGGAAGG + Intronic
945039980 2:205735673-205735695 TTGCACCTCTAGGGGAGTGGGGG - Intronic
947031167 2:225797489-225797511 TTGTACCTCCAGAACAGGGAAGG - Intergenic
1169892816 20:10472072-10472094 GCGTACCTCCAGAGGAGGGAAGG + Intronic
1172487565 20:35307514-35307536 TTGGACCTCTAGAGGAGGGAGGG + Intronic
1175089128 20:56487340-56487362 TTGCACTTCAAGAGAAGGGAAGG + Intronic
1175657348 20:60782573-60782595 TTGAACTTCTAGAGAAGTGATGG + Intergenic
1175900220 20:62357102-62357124 TGGAACCTCCAGAGGAGGGGAGG + Intronic
1176987113 21:15449989-15450011 TGGGGCCTGTTGAGGAGGGATGG - Intergenic
1180190919 21:46162060-46162082 CTGGATCTCTGGGGGAGGGAAGG + Exonic
1180695092 22:17746840-17746862 TTGGGCCTCTAGAACCGGGAGGG + Intronic
1182427012 22:30279182-30279204 TTGGACCTCTATTGGAGGTCAGG - Intergenic
1185387875 22:50544690-50544712 GTGGACCTCAAGTTGAGGGAAGG - Intergenic
950608185 3:14103352-14103374 GGGGACTACTAGAGGAGGGAGGG + Intergenic
952181900 3:30925584-30925606 TTGCACCTCTAGAGAAGAGGAGG - Intergenic
952401902 3:32970923-32970945 TAGGCCCTTTATAGGAGGGAGGG - Intergenic
954663457 3:52238072-52238094 TGGGACCCCTAGGGGAGGGGAGG + Intronic
956726230 3:72158689-72158711 TTGGTTCTCCAGAGGAGGTAGGG - Intergenic
956901952 3:73726191-73726213 TTGAGCCTCCAGGGGAGGGATGG + Intergenic
957957051 3:87201178-87201200 TTGGAGGTCTAGAGAAGGTAAGG - Intergenic
957989979 3:87615099-87615121 TTAAATCTCTAGAGAAGGGAAGG - Intergenic
958964425 3:100542873-100542895 GGGGACCACTAGAGGAGGAAGGG + Intronic
962747363 3:138406897-138406919 TTGGAGTTACAGAGGAGGGATGG - Intergenic
967274401 3:187759732-187759754 TTGGATTCCTAGAGGTGGGAGGG + Intergenic
967652123 3:191998764-191998786 TTGAACATTTAGAGGAGGGAGGG + Intergenic
968755313 4:2412830-2412852 TTCGACCTTAAGAGGAGAGATGG - Intronic
969285999 4:6202137-6202159 TTGGACGTGGACAGGAGGGAGGG + Intergenic
970724474 4:19027887-19027909 TGGGACTACTAGGGGAGGGAGGG + Intergenic
971387424 4:26154104-26154126 TTTGTCCTCTAAAGGAGAGATGG - Intergenic
971565311 4:28131843-28131865 TTGGCACTCTAGTGTAGGGAAGG - Intergenic
972679773 4:41294166-41294188 TTGGATCTCCAGAGGAAGGCTGG + Intergenic
972981208 4:44704173-44704195 ATGGGACTCTAAAGGAGGGAAGG + Intronic
973305329 4:48641754-48641776 TTGGACCTTTAAATGAGAGAAGG - Intronic
974210646 4:58770212-58770234 TGGGGCCTATAGAGGATGGAAGG - Intergenic
974593844 4:63991133-63991155 CTGGAGATCCAGAGGAGGGAGGG + Intergenic
975483632 4:74910334-74910356 TTGGGGCACTAGAGGAGGGATGG - Intergenic
975514301 4:75228617-75228639 TTGAACCTCCAAAGGAGAGAAGG - Intergenic
975824006 4:78300837-78300859 GAGCAGCTCTAGAGGAGGGAAGG - Intronic
977103804 4:92853829-92853851 GTGGACTTCTAGAGGTTGGAGGG + Intronic
979142989 4:117201770-117201792 TTGGCCCAACAGAGGAGGGAGGG + Intergenic
979708041 4:123745040-123745062 TTGGACCTCTGGCTGAGAGAAGG - Intergenic
979797470 4:124864119-124864141 GTGAACCTCCAGAGGATGGAGGG + Intergenic
980939085 4:139255580-139255602 CTGGATCTATAGGGGAGGGAAGG + Intergenic
984237067 4:177172432-177172454 TGGGACTTCTAGAGGGAGGAGGG - Intergenic
984837041 4:184031953-184031975 CTGGACCTCTAAAGCAGGGTGGG + Intergenic
986299892 5:6470137-6470159 TTTGACCTCTAAATGAAGGATGG + Intronic
988094102 5:26580610-26580632 TGGGAGCACTAGAGGAGGGAGGG - Intergenic
988320761 5:29693264-29693286 GTGGACTTCTAGAGGGAGGAGGG - Intergenic
990046683 5:51441520-51441542 TAGGAGCTCTAGAAAAGGGAGGG + Intergenic
990197539 5:53335452-53335474 GTGGAGCTCTAGAGCTGGGATGG - Intergenic
993350099 5:86839102-86839124 GTGGACCACGAGAGGATGGAGGG - Intergenic
995209651 5:109522932-109522954 GGGGACCACTAGAAGAGGGAGGG - Intergenic
995700781 5:114932758-114932780 GTGGACTTCTAGATGGGGGAGGG - Intergenic
997438062 5:133889379-133889401 TTGGGACTCTAGAGGAGGGTCGG - Intergenic
999056379 5:148582463-148582485 GGGGACCACTAGAGGAGGGAGGG - Intronic
1000535577 5:162473889-162473911 TTGCTCCTCTATAGGAGGAAGGG + Intergenic
1001608535 5:172981585-172981607 TTGGCCCTCTAGTAGAGGGTTGG + Intergenic
1002301106 5:178257622-178257644 TGGGAAGTCCAGAGGAGGGAGGG - Intronic
1002716660 5:181232348-181232370 TTAGATCTGGAGAGGAGGGAAGG + Intronic
1004039021 6:11956812-11956834 GGGGACCAATAGAGGAGGGAAGG - Intergenic
1004861960 6:19813520-19813542 TAGGAGTTCTAGAAGAGGGATGG + Intergenic
1005203591 6:23375359-23375381 GTGGACTAATAGAGGAGGGAGGG - Intergenic
1006255561 6:32829625-32829647 TAGGACCTCGGGAGGTGGGAGGG + Intronic
1006506575 6:34492802-34492824 ATGGACTTCTAGAGGAGGGAAGG + Intronic
1007227561 6:40325641-40325663 TTGGTCCTACAGAGGAGGGCTGG - Intergenic
1007469113 6:42076841-42076863 TTGAACCTCTGGAGAAGGCAGGG - Intronic
1009744694 6:67798019-67798041 TTGTACTTTTAGAGGAGGCAGGG - Intergenic
1009952044 6:70409447-70409469 ATGGACTACTAGAGGAGGAATGG + Intergenic
1014382158 6:120755526-120755548 GTAGACTGCTAGAGGAGGGAGGG - Intergenic
1015577492 6:134688708-134688730 TTGTTCCTGTAGAGGAGAGAGGG - Intergenic
1018007721 6:159638894-159638916 TTGAACCTTTAGAGAATGGAAGG + Intergenic
1018619112 6:165713558-165713580 TGGGACCAGGAGAGGAGGGAGGG + Intronic
1018797855 6:167201139-167201161 CTGGACCTCTAAAGCCGGGAAGG + Intergenic
1019045798 6:169144667-169144689 CTGGACCCATAGAGAAGGGAAGG - Intergenic
1019227973 6:170530761-170530783 TAGGAACTCCAGAGGAGGGATGG + Intergenic
1022258334 7:28681072-28681094 TTGGACCCCCACAGCAGGGATGG - Intronic
1022287229 7:28965190-28965212 CTGCAGCTCTAGGGGAGGGAAGG - Intergenic
1023505976 7:40899998-40900020 TGTGACCTCTAGAAGAGAGAGGG - Intergenic
1023636607 7:42217676-42217698 TTGCACATCTTAAGGAGGGATGG - Intronic
1025756063 7:64343398-64343420 GGGGACCACTAGAGGAGGAAAGG + Intronic
1028939211 7:96501876-96501898 TTGGACTACTAGAAGTGGGAGGG - Intronic
1031626682 7:124000466-124000488 GTGGACTACTAGAGAAGGGAGGG + Intergenic
1033348211 7:140541524-140541546 TTCCACCTCTAGCGGATGGAGGG + Intronic
1036436720 8:8741735-8741757 GTGAACCACTAGAGGAGAGAGGG + Intergenic
1037643398 8:20769250-20769272 TGAGACCTCTGTAGGAGGGATGG - Intergenic
1037681734 8:21103297-21103319 TTTGAGCTGGAGAGGAGGGAAGG + Intergenic
1043374726 8:79635744-79635766 GTGGACTACTAGAGGGGGGAAGG + Intronic
1045045336 8:98269838-98269860 TGGGAACTCTGGAGGAGGGAGGG - Intronic
1046112183 8:109738521-109738543 TTGGACGTATGGATGAGGGATGG - Intergenic
1051389419 9:16547951-16547973 CTGGACCTCTAAAAGACGGATGG + Intronic
1051542708 9:18237987-18238009 TTTGCCCTCTAGAGGCTGGAGGG + Intergenic
1052296626 9:26903186-26903208 TTGTACCACTAGAGGTGCGATGG + Intergenic
1052667419 9:31513212-31513234 TTGGGCGGCTAGGGGAGGGATGG - Intergenic
1060784693 9:126441510-126441532 TTTAACCTTTAGAGGAGGAAAGG + Intronic
1061685173 9:132270483-132270505 TGTGACTTCTAGAGGAGTGAAGG - Intronic
1062589442 9:137266809-137266831 GGGGACCTGGAGAGGAGGGAGGG + Intronic
1185625140 X:1475947-1475969 TTGAACCACTAGGGTAGGGAAGG + Intronic
1185686933 X:1937095-1937117 TTGGACTTCCAGATGAGGAATGG + Intergenic
1188297149 X:28463356-28463378 TTGGAAGTCTAGAGGGCGGAAGG + Intergenic
1188804689 X:34572282-34572304 GTGGACTACTAGAGGATGGAAGG + Intergenic
1189809518 X:44768337-44768359 ATGGACTCCTAGAGGATGGAGGG + Intergenic
1193272088 X:79541070-79541092 GAGGACTGCTAGAGGAGGGAGGG - Intergenic
1193786258 X:85762896-85762918 GGGGACCACTAAAGGAGGGAGGG - Intergenic
1193793503 X:85845029-85845051 TAGCACCTCTGGAGGAAGGAAGG + Intergenic
1194245489 X:91506531-91506553 TTGGACTTCTAGAGAGGGGAGGG + Intergenic
1194434467 X:93853271-93853293 TGGGTACTCTAGAGGAGGGACGG - Intergenic
1200381093 X:155838061-155838083 GTGGACTACTAGAGGTGGGAGGG + Intergenic
1200564459 Y:4747783-4747805 TTGGACTTCTAGAGAGGGGAGGG + Intergenic
1201743025 Y:17343792-17343814 TTGGACCTCAAGAGGGGGTTTGG + Intergenic
1202166059 Y:21989377-21989399 TAGGCCCTTTATAGGAGGGAGGG + Intergenic
1202225299 Y:22596996-22597018 TAGGCCCTTTATAGGAGGGAGGG - Intergenic
1202317814 Y:23598665-23598687 TAGGCCCTTTATAGGAGGGAGGG + Intergenic
1202552952 Y:26071393-26071415 TAGGCCCTTTATAGGAGGGAGGG - Intergenic