ID: 1172491513

View in Genome Browser
Species Human (GRCh38)
Location 20:35342270-35342292
Sequence GCTCATTGTGAGCCACAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 105}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172491510_1172491513 5 Left 1172491510 20:35342242-35342264 CCATCTCTGTCTTGGAAAGCTTG No data
Right 1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 105
1172491503_1172491513 21 Left 1172491503 20:35342226-35342248 CCACTCCCATCCCTTCCCATCTC 0: 1
1: 2
2: 105
3: 1410
4: 8263
Right 1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 105
1172491507_1172491513 11 Left 1172491507 20:35342236-35342258 CCCTTCCCATCTCTGTCTTGGAA 0: 1
1: 0
2: 5
3: 39
4: 1152
Right 1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 105
1172491502_1172491513 22 Left 1172491502 20:35342225-35342247 CCCACTCCCATCCCTTCCCATCT 0: 1
1: 0
2: 8
3: 123
4: 1232
Right 1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 105
1172491505_1172491513 15 Left 1172491505 20:35342232-35342254 CCATCCCTTCCCATCTCTGTCTT 0: 2
1: 1
2: 30
3: 334
4: 2652
Right 1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 105
1172491504_1172491513 16 Left 1172491504 20:35342231-35342253 CCCATCCCTTCCCATCTCTGTCT 0: 1
1: 1
2: 12
3: 133
4: 1200
Right 1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 105
1172491508_1172491513 10 Left 1172491508 20:35342237-35342259 CCTTCCCATCTCTGTCTTGGAAA 0: 1
1: 1
2: 3
3: 26
4: 357
Right 1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 105
1172491509_1172491513 6 Left 1172491509 20:35342241-35342263 CCCATCTCTGTCTTGGAAAGCTT 0: 1
1: 0
2: 3
3: 15
4: 193
Right 1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG 0: 1
1: 0
2: 1
3: 15
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172491513 Original CRISPR GCTCATTGTGAGCCACAAGG TGG Intronic
902533384 1:17104908-17104930 GCTCATGGTGACCCGCAGGGTGG + Exonic
902925219 1:19691530-19691552 GCCCAGTGTGAGCCACACTGTGG + Intronic
903982318 1:27198090-27198112 GTTCATAGTGAGCCACAAGGTGG + Intergenic
908433070 1:64077932-64077954 GCTCAATGTGAGGGACATGGAGG + Intronic
911104467 1:94118936-94118958 GCTCTTTGTGACCCTCAAAGGGG - Intronic
916169413 1:161989361-161989383 GCTGAGTGTGAGACAAAAGGTGG + Intronic
921188916 1:212692944-212692966 GCTCATTGGGAGACACCAGAGGG - Intronic
1063072370 10:2679796-2679818 GCTCAAGGTGGGCCACGAGGGGG - Intergenic
1068180617 10:53513452-53513474 GCACTTTGTGAGCCCCAAAGTGG - Intergenic
1069967678 10:72134881-72134903 TCTAATTGTGAGAAACAAGGAGG - Intronic
1070837474 10:79458919-79458941 GCTGATTGCAAGCCTCAAGGTGG - Intergenic
1073130232 10:101183789-101183811 GCTCTGTGTGAGCAACAAGACGG + Intergenic
1074157015 10:110808103-110808125 GTTCATTGTGTGGCCCAAGGTGG + Intronic
1077810572 11:5632445-5632467 CATCACTGTGAGCAACAAGGAGG + Exonic
1079137971 11:17787049-17787071 ACTCATTCTGAGTCACAAGGAGG + Intergenic
1081615369 11:44587648-44587670 GTTCAGTCTGAGCCACCAGGTGG + Intronic
1083431665 11:62616535-62616557 GGTCCTTGGGATCCACAAGGTGG + Exonic
1086230104 11:84558263-84558285 ATTCACTGTCAGCCACAAGGTGG + Intronic
1089255956 11:117193982-117194004 GCTCCTTGTGAGCCAACAAGTGG + Intronic
1093966390 12:25331496-25331518 TCTCACTGGGAGCCCCAAGGTGG - Intergenic
1096672197 12:53206701-53206723 GCCCACTGGGAGTCACAAGGAGG + Intronic
1099929221 12:89053954-89053976 AATCATGGTGACCCACAAGGAGG + Intergenic
1101649059 12:106658522-106658544 GCAAATTCTGAGCCACAAGGAGG - Intronic
1104418710 12:128617279-128617301 CCTCTTTGTTAGTCACAAGGTGG + Intronic
1106008829 13:25798164-25798186 GCTCATTATGTGACACATGGTGG - Intronic
1106457981 13:29944265-29944287 GCTCCTGGTCAGCCAGAAGGAGG - Intergenic
1110941101 13:81349964-81349986 GGACATTGTGAGCCACAAAAAGG - Intergenic
1113328440 13:109306346-109306368 GCTCATTGTGAGCAGCAACATGG + Intergenic
1113593002 13:111513856-111513878 GCTCATGGTGACCTGCAAGGGGG + Intergenic
1117351365 14:54884916-54884938 GCTCAATGAGACCCATAAGGTGG + Intronic
1129523369 15:76199469-76199491 ACTCATTGTAACCCCCAAGGAGG - Intronic
1134979419 16:18595017-18595039 GCTCAGTGTGAGTCACACAGTGG + Intergenic
1135056531 16:19236712-19236734 GCTGTTTGTGACTCACAAGGCGG - Intronic
1137735673 16:50721110-50721132 GCTCAGTTTGAGCCACAAATGGG + Intronic
1139450829 16:67027262-67027284 TCTCATTGTCAGCCTCAAGGAGG - Intergenic
1141234070 16:82199305-82199327 TATCATTTTGAGCCAGAAGGAGG + Intergenic
1144625752 17:16843696-16843718 GCACATTGAGAACCTCAAGGAGG - Intergenic
1144880681 17:18429024-18429046 GCACATTGAGAACCTCAAGGAGG + Intergenic
1145151556 17:20515363-20515385 GCACATTGAGAACCTCAAGGAGG - Intergenic
1146661759 17:34669627-34669649 GCTTATTGTGAGCCAAAGGCAGG + Intergenic
1150990415 17:70251450-70251472 GCTCTTTCTGAGCAACAAGGAGG + Intergenic
1151131933 17:71905646-71905668 GCTCTACGTTAGCCACAAGGAGG + Intergenic
1152889413 17:82871913-82871935 GCTCGTTGTGAGGCACACGCTGG + Intronic
1152889415 17:82871942-82871964 GCTCGTTGTGAGGCACACGCTGG + Intronic
1153139288 18:1954032-1954054 CCACATTGTGGGCCACAAGGAGG - Intergenic
1156373762 18:36494209-36494231 GATCTTTGTGGGCCACAAAGGGG + Intronic
1156939910 18:42754699-42754721 GCTTATTGTGTGGCACAATGAGG - Intronic
1162332506 19:10038934-10038956 GTTCACTGTGAACCACAAGATGG + Intergenic
1165341339 19:35214315-35214337 GCCCAGCCTGAGCCACAAGGCGG - Intergenic
1165435334 19:35792012-35792034 GCTCCTTGGGGTCCACAAGGGGG + Intergenic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1168018735 19:53594060-53594082 GCCCTTTGGGAGCCACAAGGTGG - Intergenic
927960494 2:27238082-27238104 GCTCTGCGTGAGCCACAATGGGG - Exonic
928202321 2:29256103-29256125 GCTCACTTTGATCCACAAAGTGG - Intronic
936154780 2:110040624-110040646 GCTCTTTGTGAGGAACAAAGGGG + Intergenic
936189903 2:110330790-110330812 GCTCTTTGTGAGGAACAAAGGGG - Intergenic
936820120 2:116510395-116510417 GCTCATGGTCAGCCCCAAGAGGG + Intergenic
937255366 2:120551828-120551850 GCTAGTTGTGGGCCACAGGGAGG + Intergenic
940120247 2:150256436-150256458 GCTCATAGTGATGAACAAGGAGG - Intergenic
941600539 2:167537732-167537754 GATCATTTTGAGCCACCAGTAGG - Intergenic
943472986 2:188318487-188318509 GCTCAATATGAGGCAGAAGGTGG + Intronic
1169526289 20:6429678-6429700 CCTCGTTGTGAGCCACATGAGGG - Intergenic
1172152911 20:32803047-32803069 GCTCATGGTGACCAACCAGGTGG + Intronic
1172176419 20:32974981-32975003 GCTTTGTGTGAGCAACAAGGCGG - Intergenic
1172491513 20:35342270-35342292 GCTCATTGTGAGCCACAAGGTGG + Intronic
1175957365 20:62618262-62618284 GCCCACTGTGAGACACGAGGAGG + Intergenic
1178573622 21:33764365-33764387 GCTAATTGTGAGACACAAAAAGG + Intronic
1179466782 21:41581193-41581215 GTTCATTGTCAGCCACAAAAAGG - Intergenic
1181139521 22:20794257-20794279 GCTCCTTGTCCTCCACAAGGTGG + Intronic
1181697474 22:24601224-24601246 GATCATTGTGAGCCTCATGATGG + Intronic
1182535127 22:30995443-30995465 GCTCATTATGAGACAAGAGGAGG - Intergenic
1183454894 22:37917279-37917301 GCTCCTTGTCAACCCCAAGGAGG + Intronic
1183784374 22:40021155-40021177 GCTCCTTGTGGGCCACACGCTGG - Intronic
949935337 3:9111566-9111588 TCCCATTGTGAGCCAGATGGGGG - Intronic
953260756 3:41336850-41336872 GCTCATTGTCAGTAACATGGAGG + Intronic
956455994 3:69421014-69421036 ACTCAGTGTGAGCCACAATGGGG - Intronic
962304969 3:134277995-134278017 GCTCATAGTGAGCCAGTAGTTGG + Intergenic
962797515 3:138861985-138862007 CCACATTGTGAGGCAGAAGGAGG - Intergenic
964233399 3:154496574-154496596 CCTCATTGTGTGCCTTAAGGAGG + Intergenic
964791038 3:160453255-160453277 GGTCCTTGGGATCCACAAGGTGG - Intronic
970008303 4:11430623-11430645 ACCCATTGTGAGACACAAAGGGG + Intergenic
970774424 4:19655903-19655925 GCTTATAGTGAGCAACAAAGTGG + Intergenic
972164355 4:36264545-36264567 GCTAAATTTGAGCCACAAAGGGG + Intergenic
974103309 4:57440927-57440949 GCACACTGTGAACCACAAGCTGG - Intergenic
975735461 4:77376883-77376905 GCTCATCCTGAGTCACAAAGAGG + Intronic
980441713 4:132856428-132856450 GGTGGTTGTGAGGCACAAGGGGG + Intergenic
988565837 5:32319662-32319684 CCATATTGTGGGCCACAAGGAGG - Intergenic
988856451 5:35232233-35232255 GCTGAGTGGGAACCACAAGGAGG - Intergenic
991478496 5:67050104-67050126 GCTCAGTGTGAGGGACAAAGAGG - Intronic
991968311 5:72113047-72113069 GCTCCTTGTTAGGCACAAAGGGG + Intronic
992180844 5:74196997-74197019 GCTCATAGTGATACCCAAGGGGG - Intergenic
996796628 5:127354869-127354891 CCTCAGTGTCAGCCACAGGGGGG + Intronic
998717364 5:144900387-144900409 GCTAATTGTTAGCCAAAATGTGG - Intergenic
1000341163 5:160278432-160278454 GGCCATTGTGGGCCACAAGGGGG - Intronic
1001686787 5:173599412-173599434 GCTCATTGTCAGCCACTCGGTGG - Intergenic
1002776510 6:332501-332523 GCTCATCGGGTGCCACAAAGGGG + Intronic
1003202842 6:3978148-3978170 GCACATTGTGGACCACAAGGAGG - Intergenic
1005129746 6:22492413-22492435 GCTATTTATGAGCCAGAAGGTGG + Intergenic
1012448455 6:99330249-99330271 GCTCACTGACATCCACAAGGGGG + Intronic
1020375697 7:7483140-7483162 GCCCATTGTAAGTCATAAGGAGG - Intronic
1022051796 7:26681982-26682004 ACTCATTCTGAGCCACTAGATGG + Intronic
1022465484 7:30650345-30650367 GCTCAGTGGGAGCCACAACCAGG + Intergenic
1023682605 7:42702925-42702947 GCTAATTGTGAGCCAAACTGAGG - Intergenic
1024058684 7:45682545-45682567 GCACAATGTGGTCCACAAGGTGG + Intronic
1024361065 7:48469258-48469280 GCTCATTATTAGCCAAAAGGTGG + Intronic
1027958006 7:84906736-84906758 GCTATTTTAGAGCCACAAGGTGG + Intergenic
1028283121 7:88958597-88958619 ACATATGGTGAGCCACAAGGTGG - Intronic
1029114474 7:98230306-98230328 GGACATTGAGAGCCACAAGGTGG - Intronic
1031582565 7:123494366-123494388 TATCATTATGAGCCACAAGAGGG + Intronic
1035482387 7:159197872-159197894 CCTCAATGTCAGCAACAAGGGGG + Intergenic
1045123312 8:99062713-99062735 GCACTTTGGGATCCACAAGGCGG - Intronic
1046224692 8:111262337-111262359 GCTCAGTGTGAGCCCCAAAGGGG - Intergenic
1051602206 9:18886633-18886655 TCTCATTGTGTCCCACATGGTGG + Intronic
1057814873 9:98287020-98287042 GCCCATTCTGAGCTACAGGGAGG + Intergenic
1058721534 9:107768805-107768827 ACTCATTTTGAGCCACAATGCGG + Intergenic
1058776859 9:108293129-108293151 GCTCAGTGGGAGCCACATGGTGG - Intergenic
1059357540 9:113711607-113711629 GCTCTGTCTGAGGCACAAGGAGG + Intergenic
1060062628 9:120474746-120474768 ACTCATTGTGAGCAAGAATGTGG - Intronic
1060984727 9:127813478-127813500 CCCCACTGTGAGCCACAGGGTGG - Exonic
1061305122 9:129727951-129727973 GCTCTGTGTGAGGCACCAGGGGG - Intergenic
1061400577 9:130366024-130366046 CCTCATTGCCAGGCACAAGGAGG + Intronic
1186088786 X:6021506-6021528 GGGCATTTTGAGCCACTAGGAGG + Intronic