ID: 1172493984

View in Genome Browser
Species Human (GRCh38)
Location 20:35364928-35364950
Sequence GAGGGTTGCAAGAAGGCTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 175}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172493984 Original CRISPR GAGGGTTGCAAGAAGGCTAG GGG (reversed) Intronic
902327990 1:15715162-15715184 AAGGCTGGCAAGAAGGCTGGTGG + Intronic
902634925 1:17728879-17728901 GAGGGCTGCAGGATGGCTTGAGG - Intergenic
903548429 1:24141483-24141505 CTGGGTTGCAAGGAGGCTGGTGG + Intronic
911530218 1:99035555-99035577 GATGGTTGCCAGGAGGCTGGGGG + Intergenic
912681325 1:111730891-111730913 GAGGGTAGCAAGCAGCCTGGAGG - Intronic
913123876 1:115767528-115767550 GAGGGTGCCAAGAATGCTAGTGG - Intronic
913530201 1:119728577-119728599 GAGGGTTGCAATCAGGCTAAGGG - Intronic
914347926 1:146815684-146815706 CAGGGTTGCAACAAGGTCAGTGG - Intergenic
914504853 1:148280414-148280436 GAGGGTTCCCAGAATCCTAGCGG + Intergenic
915200072 1:154220832-154220854 GAGGGACGCAGGAAGGCAAGTGG + Exonic
916889726 1:169104251-169104273 GAGGTTTTCAGGAAGGCTGGAGG + Intergenic
917745564 1:178003325-178003347 GGGAGCTGAAAGAAGGCTAGTGG - Intergenic
919018458 1:192072050-192072072 GAGGGTTTCAGAGAGGCTAGAGG - Intergenic
919403173 1:197146074-197146096 GAGGGTGGCAGGAAAGATAGCGG + Intronic
921527037 1:216230107-216230129 GAGTGTTGCAAGGAGGACAGTGG + Intronic
1062974572 10:1674090-1674112 GAGGGCTGCAAGGAGGCCACTGG + Intronic
1067878333 10:50023832-50023854 GAGGGTGGCAAGCAGGATAGGGG - Intergenic
1067893389 10:50154096-50154118 GAGGGTGGCAAGCAGGATAGGGG + Intergenic
1070363885 10:75717169-75717191 GGGGGTTGGAAGAGGGCTAGTGG + Intronic
1071292556 10:84197988-84198010 GAGGGCTGCAGCAAGGCCAGGGG + Intronic
1072008018 10:91274823-91274845 GAGAATTGCAAGGAGGCCAGTGG + Intronic
1072429482 10:95358105-95358127 AAGGGTTGGAGGAAGGATAGGGG + Intronic
1073599926 10:104836684-104836706 GAAGGGTGCAAGAAGGAGAGTGG - Intronic
1074895520 10:117773891-117773913 GGGGGTAGTTAGAAGGCTAGAGG - Intergenic
1075069368 10:119310615-119310637 TAGTGTTGCAAGAGGACTAGGGG + Intronic
1077953791 11:6991287-6991309 GAGGGAAGCAGGGAGGCTAGGGG - Intergenic
1079728232 11:23904530-23904552 GAGGGTTACAGGAAGGCTCAAGG - Intergenic
1082119446 11:48362548-48362570 CAGGGTTCCAAGAAGGTGAGAGG - Intergenic
1083860501 11:65417713-65417735 GAGGGTTGGAGGAGGTCTAGGGG + Intergenic
1086125843 11:83347641-83347663 GAAGGTCACAAGAAAGCTAGAGG - Intergenic
1087542287 11:99534947-99534969 GAGAACTGAAAGAAGGCTAGTGG + Intronic
1089696374 11:120218646-120218668 GAGGGTTGGAAGAATGGGAGGGG + Intronic
1091955083 12:4633561-4633583 GAAGGTTGCAAGAGGGCAAGGGG - Intronic
1091997079 12:5002133-5002155 GAGGGCTGGATGAAGGGTAGCGG + Intergenic
1092725098 12:11477134-11477156 CAGAGCTGCAAGAAGGCTAAAGG + Intronic
1096981454 12:55729902-55729924 GAGGGCTGGAAGCGGGCTAGGGG + Intergenic
1097019223 12:56007888-56007910 GAGGGTTGGAAGATGGCCGGGGG + Intronic
1099590457 12:84580955-84580977 GAGGGTTTACAGAAGGCAAGAGG + Intergenic
1099773772 12:87098816-87098838 CAAGGTGGCAACAAGGCTAGGGG + Intergenic
1105683378 13:22752378-22752400 GAAGGTGGCAAGAGGGGTAGGGG - Intergenic
1105782030 13:23714218-23714240 GAGGGTGACAAGCAGGTTAGGGG - Intergenic
1105804025 13:23939151-23939173 GAGGGTGACAAGCAGGTTAGGGG - Intergenic
1105806694 13:23955628-23955650 GAGAGTGGCAAGCAGGCTACAGG + Intergenic
1107414918 13:40191578-40191600 GGGGGTTGGAAGAAGGGGAGGGG - Intergenic
1110342524 13:74409548-74409570 GAGGACTGCAAGAAGCCCAGAGG + Intergenic
1113318891 13:109213230-109213252 CATGGTTGGCAGAAGGCTAGTGG - Intergenic
1116246279 14:42417215-42417237 GAGGATTGGAGGAAAGCTAGAGG + Intergenic
1116863004 14:50009273-50009295 GAGAGTGGCAAGATGGCTACCGG - Intergenic
1117551592 14:56842653-56842675 GAGGCTTGCAGGTAGGCTTGGGG + Intergenic
1118300873 14:64614862-64614884 TGGGGTTGCAAGAAGGGTAGTGG + Intergenic
1118360617 14:65053554-65053576 GGGGGTTGCATGCAGGCTGGGGG - Intronic
1118737020 14:68708471-68708493 GAGAGTCCCAAGAAGGCCAGTGG - Intronic
1119880503 14:78095859-78095881 GAGGGTTGCAAGCAGCCAATAGG - Intergenic
1122839107 14:104446141-104446163 GAGGGTGTCAAAAAGGCCAGAGG - Intergenic
1122979702 14:105185924-105185946 GAGGGGTGCAGGAAAGCCAGGGG + Intergenic
1124130126 15:26976370-26976392 GAGGCGTGCAAGATTGCTAGAGG + Intronic
1124230749 15:27944275-27944297 GAGGGCAGCTTGAAGGCTAGAGG - Intronic
1125446175 15:39759750-39759772 GATGGTTGCCAGCAGGCTTGAGG + Intronic
1125449060 15:39788956-39788978 GAGTTTTGCAAGAAGGCCTGAGG - Intergenic
1127332312 15:57951244-57951266 GAGGAATACAAGATGGCTAGGGG - Intergenic
1131002459 15:88949749-88949771 GAGGGTAAGAAGAAGGCTATGGG - Intergenic
1131369355 15:91866951-91866973 GAGGGTAGCAAGATGTCAAGTGG + Intronic
1131766016 15:95676764-95676786 GAGGGATGCAAGAAAATTAGAGG - Intergenic
1136172944 16:28499262-28499284 GAGGGGTTCAGGATGGCTAGAGG + Intergenic
1138249580 16:55491776-55491798 GAGGGTTGCAGGGAGGAGAGAGG - Intronic
1139559876 16:67735142-67735164 GAGAGTTGCAGCAAGGCTGGAGG + Intronic
1139986109 16:70899848-70899870 CAGGGTTGCAACAAGGTCAGTGG + Intronic
1144450619 17:15375028-15375050 GGGGGCTGCAAAAAGGCTACAGG - Intergenic
1144877830 17:18411575-18411597 GAGGGTGGGAAGAAGGCGATGGG - Intergenic
1144877839 17:18411608-18411630 GAGGGTGGGAAGAAGGCGATGGG - Intergenic
1145154390 17:20532814-20532836 GAGGGTGGGAAGAAGGCGATGGG + Intergenic
1145193800 17:20869296-20869318 AAGGGTGGCAAGCAGGATAGGGG + Intronic
1145352023 17:22091524-22091546 AAGGGTGGCAAGCAGGATAGGGG + Intergenic
1147487509 17:40831552-40831574 GGGGGTTGTAAGAATGGTAGAGG + Intronic
1151438181 17:74111247-74111269 GAGGGTTTCAAGCCGGCCAGTGG - Intergenic
1153174763 18:2358236-2358258 GAGGGTTGCAAGAAAGGTGAGGG - Intergenic
1154484769 18:14864981-14865003 GAGGGTGGCAAGCAGGACAGAGG - Intergenic
1158634497 18:59144774-59144796 AGGGGTTGCAAGGAGGGTAGAGG + Intronic
1164541662 19:29126003-29126025 GAGGGTGGCAAGAAGAGGAGGGG + Intergenic
1164937082 19:32223392-32223414 GAGGGTAGAAGGAAGGATAGAGG + Intergenic
1165975699 19:39674567-39674589 GAGGGTTGAAAGAAGAACAGTGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167488897 19:49780603-49780625 GAGGGAGGCAAGAAGGCTGGAGG + Intronic
925332437 2:3069154-3069176 GGGGGTTGCCAGGAGGCTGGGGG + Intergenic
926322307 2:11757589-11757611 GAGGGGTGCAGGCAGGTTAGAGG - Intronic
926460294 2:13121419-13121441 GAGGCATGAAAGAAGGCCAGAGG + Intergenic
926653944 2:15378374-15378396 GAGAGTTGGAAAATGGCTAGTGG + Intronic
928950057 2:36806438-36806460 GAGGGTAGAAAAAAGGCAAGAGG - Intronic
929024965 2:37591652-37591674 GAGGATTGCTTGAAGGCCAGGGG + Intergenic
929873324 2:45775885-45775907 CAGGGATGCAAGGAGGCCAGTGG - Intronic
934511300 2:94946587-94946609 GAGGGTGGCAAGCAGGATAGGGG - Intergenic
936983577 2:118287309-118287331 GAGGACTGCAAGAAGGCCATAGG + Intergenic
937997804 2:127708354-127708376 GAGGGTTCCAAGCAGCCTTGTGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
939813946 2:146870977-146870999 GAGGGATGCAAGAGAGTTAGAGG + Intergenic
939992752 2:148890625-148890647 GGGGCTTGAAAGAGGGCTAGAGG + Intronic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
943792387 2:191948053-191948075 GAGAGTTGCAGGAAGGCTGTGGG + Intergenic
944003260 2:194868136-194868158 AAGGGTTGCTATAAGGCTGGAGG - Intergenic
946042350 2:216793046-216793068 CAGGGTTCCAAGGAGGCAAGGGG + Intergenic
948962777 2:241354504-241354526 GTGGGCAGGAAGAAGGCTAGAGG - Intergenic
1171562356 20:26136815-26136837 GAGGGTGGCAAGCAGGATAGGGG + Intergenic
1171838540 20:30180513-30180535 GAGGGTGGAAAGAAGCCTCGTGG - Intergenic
1172449626 20:35012790-35012812 GAGGGTTAGAAGAAAGCTTGGGG + Intronic
1172493984 20:35364928-35364950 GAGGGTTGCAAGAAGGCTAGGGG - Intronic
1173317588 20:41959017-41959039 GAGGGTTGCATGCAGGAAAGAGG + Intergenic
1174965619 20:55211193-55211215 GAGGGTGGAAGGGAGGCTAGGGG + Intergenic
1176723520 21:10412335-10412357 GAGGGTGGCAAGCAGGATAGAGG - Intergenic
1176796556 21:13374494-13374516 GAGGGTGGCAAGCAGGACAGAGG + Intergenic
1178489716 21:33041678-33041700 GAGGATCGCAAGTAGGCTATGGG + Intergenic
1179195518 21:39159189-39159211 CAAGGTAGAAAGAAGGCTAGGGG + Intergenic
1179615579 21:42581073-42581095 GAGGGCAGCAGGAAGGCCAGGGG - Exonic
1180304678 22:11065108-11065130 GAGGGTGGCAAGAAGGAAAGAGG - Intergenic
1180397551 22:12367665-12367687 GCGGGTTGCGAGGAGGCGAGAGG + Intergenic
1180402169 22:12496470-12496492 GCGGGTTGCGAGGAGGCGAGAGG - Intergenic
1181119848 22:20658360-20658382 GAGGGTGGCAAGCAGGCTAGGGG + Intergenic
1181444142 22:22956009-22956031 CAGGGTTGCAAAAAGCCCAGTGG - Intergenic
1183095385 22:35548883-35548905 GAGGACTGCAAGAAGGCTTGTGG + Intronic
950431347 3:12952872-12952894 GAGGGCTCCAAGAAGGCATGTGG + Intronic
953055366 3:39383636-39383658 GAGGCCTTGAAGAAGGCTAGGGG - Exonic
955543277 3:60000595-60000617 GAGGGTAGGAAGAATGCTAGAGG + Intronic
959420253 3:106119523-106119545 GAGGGATGGAAAAAGCCTAGAGG - Intergenic
960696711 3:120403251-120403273 GAGGGTTGAAAGATGGGTTGAGG + Exonic
962060296 3:131919550-131919572 GAGGGATACAAGAAGGCTTCTGG + Intronic
968242467 3:197102924-197102946 GAGGGGTGCAGGAAAGATAGAGG + Intronic
969047660 4:4348709-4348731 GAGTGTTACAATAAAGCTAGTGG + Intronic
969683881 4:8658175-8658197 TAGGGTTGCCAGGAGGCTTGAGG - Intergenic
970410189 4:15798441-15798463 GAGGGTTGAAAGAGGGCTGCTGG - Intronic
970848185 4:20568627-20568649 GCCGGTTGCAAGAAGGCAAATGG - Intronic
973858248 4:55035001-55035023 GAGTGTGGAAAGAAGGCAAGAGG - Intergenic
983427015 4:167597963-167597985 GAGGGATGTAAAAAGGTTAGTGG - Intergenic
983744659 4:171182808-171182830 GAGGTTTGTAAGAAGGTAAGTGG + Intergenic
984310922 4:178057088-178057110 GAGGCTGGCAAGAAGTCTGGAGG - Intergenic
987838819 5:23196738-23196760 CAGGGTTGAAAGAGGGCAAGAGG - Intergenic
996651453 5:125881974-125881996 GAGTTTTGGAAGAAGGCTAAGGG + Intergenic
997024639 5:130044283-130044305 GAGTGTTTCAAGAAGGGGAGAGG + Intronic
998112506 5:139513116-139513138 GGGGTTTACAAGAAGGCTAGTGG + Intergenic
998136269 5:139676218-139676240 GAGGGTGGCAAGAAGGACTGTGG - Intronic
998136280 5:139676254-139676276 GAGGGTGGCAAGAAGGACTGTGG - Intronic
1001749309 5:174116789-174116811 GAGGGCTGCGAGGAGGCTGGAGG - Intronic
1001981104 5:176037521-176037543 GAGGGTGGCAAACAGGATAGAGG + Intergenic
1002236356 5:177806545-177806567 GAGGGTGGCAAACAGGATAGAGG - Intergenic
1002723493 5:181280427-181280449 CAGGGTGGCAAGCAGGATAGAGG - Intergenic
1004401586 6:15293857-15293879 AAGGGTTGCATGCAGGCCAGTGG + Intronic
1004634404 6:17453210-17453232 GAGACTTGGAAGAATGCTAGAGG + Intronic
1006866651 6:37214050-37214072 GAGGGCTGGAGGGAGGCTAGTGG - Intronic
1007252291 6:40504015-40504037 GAGGGTCGCCAGAGGGCTTGTGG + Intronic
1010341654 6:74760348-74760370 GAGGGTTTCAGGAATGCAAGGGG + Intergenic
1011101255 6:83725214-83725236 GATTGTTGCCAGAAGGCAAGAGG - Intergenic
1012602379 6:101114231-101114253 GATGGTTGCAACAAGTATAGTGG + Intergenic
1015036940 6:128667467-128667489 GAGAGTGGCAAGATGGCTACTGG - Intergenic
1017067553 6:150543334-150543356 GGGAATAGCAAGAAGGCTAGTGG - Intergenic
1017174304 6:151488412-151488434 GAGGATTCAAAGAAGGCTCGTGG + Intergenic
1017846468 6:158262669-158262691 GAAGGCTGGAAGAAGGCTGGAGG + Intronic
1024202711 7:47122717-47122739 GAGGGATGCAGGAAGGTCAGTGG - Intergenic
1028418892 7:90610440-90610462 GAGGGTCGCAAGAAGGCTTAGGG - Intronic
1028517668 7:91696568-91696590 GAGGGTTGGAAAAGGGCAAGAGG - Intronic
1031147429 7:118012485-118012507 GAGGGTTGCAAAATGGGTGGGGG - Intergenic
1032003750 7:128283834-128283856 GAGGACTGAAAGAAGGCTGGTGG - Intergenic
1032982995 7:137306377-137306399 GAGGGTAGAAAGAAGGATAAAGG + Intronic
1036961101 8:13245291-13245313 TAGGGTTGCAAGACAGCTAGAGG - Intronic
1037365616 8:18118868-18118890 GATGATTGTAAGAAGGCTACTGG + Intergenic
1040629516 8:49194080-49194102 GAGGGAAGAAAGGAGGCTAGAGG + Intergenic
1040835507 8:51726348-51726370 GTGGGATGTAAGCAGGCTAGAGG - Intronic
1042066884 8:64887310-64887332 GAAGGTAGCAAGAAGGTAAGGGG + Intergenic
1043147990 8:76680465-76680487 GACGGTTGCAAGAATGATGGGGG - Intergenic
1047878975 8:129171485-129171507 GAGGGATGCAGGAAGGTTGGAGG + Intergenic
1049464701 8:142745552-142745574 GATGGTTGCAAGAAAGCCAAGGG + Intergenic
1050487712 9:6151741-6151763 GGGGCTTGCAAAAAGGGTAGAGG - Intergenic
1053885672 9:42643838-42643860 GAGGGTGGCAAGCAGGATAGAGG - Intergenic
1053904460 9:42826856-42826878 AAGGGTGGCAAGCAGGATAGGGG + Intergenic
1054224690 9:62451287-62451309 GAGGGTGGCAAGCAGGATAGAGG - Intergenic
1054530525 9:66178658-66178680 AAGGGTGGCAAGCAGGATAGGGG - Intergenic
1055272214 9:74573947-74573969 TAGGGTTTCAGTAAGGCTAGAGG + Intronic
1055513584 9:77017122-77017144 GAAGCTTGCAAGAAGGCCCGGGG - Intergenic
1055537733 9:77267059-77267081 GAGTGTTGAAAAAAGGTTAGAGG - Intronic
1055731063 9:79279679-79279701 CAGAGTTGGCAGAAGGCTAGGGG + Intergenic
1057379623 9:94555913-94555935 GAGGGTGGCAAGCAGTATAGGGG + Intergenic
1058111658 9:101037034-101037056 GTGGGTGGCAAGAAGGTTATGGG - Intronic
1059243211 9:112826317-112826339 GAGGGTTGGCAGAAGGCTGGGGG + Intronic
1060743717 9:126116376-126116398 GGGGGTTGTGAGCAGGCTAGAGG + Intergenic
1203626716 Un_KI270750v1:32408-32430 GAGGGTGGCAAGCAGGGTAGGGG - Intergenic
1187786435 X:22892764-22892786 CAGGGTTGAAAAAAGGCCAGGGG + Intergenic
1188281398 X:28274396-28274418 GAAGGGAGGAAGAAGGCTAGAGG + Intergenic
1190488289 X:50953371-50953393 GAGGTATGCAAGAAAGCAAGGGG + Intergenic
1194027477 X:88770646-88770668 CAGGGTTGCAAGAATGGAAGGGG + Intergenic
1194089244 X:89565016-89565038 GAGGAATGCAACAAGGTTAGAGG - Intergenic
1197137686 X:123082205-123082227 GAGGTTTGCAAGAAGGATGGAGG - Intergenic
1198121783 X:133600656-133600678 GAGTGTTGAAAGAAGGGTAATGG + Intronic
1198419365 X:136454076-136454098 TAGGGTGGCAAGAAGCTTAGAGG + Intergenic
1200182676 X:154160293-154160315 GAGCCTTGCAAGAAGACTGGAGG - Intergenic
1200188330 X:154197407-154197429 GAGCCTTGCAAGAAGACTGGAGG - Intergenic
1200193980 X:154234547-154234569 GAGCCTTGCAAGAAGACTGGAGG - Intergenic
1200199735 X:154272351-154272373 GAGCCTTGCAAGAAGACTGGAGG - Intronic
1201552542 Y:15233919-15233941 GAGGGTTGAATGAATGCTAATGG + Intergenic
1201739509 Y:17308399-17308421 GAGGGTGGCAAGAAGGCAGATGG - Intergenic