ID: 1172496921

View in Genome Browser
Species Human (GRCh38)
Location 20:35393997-35394019
Sequence TAGCCAACCAAATTGTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 77}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172496921_1172496922 15 Left 1172496921 20:35393997-35394019 CCATCACACAATTTGGTTGGCTA 0: 1
1: 0
2: 1
3: 11
4: 77
Right 1172496922 20:35394035-35394057 ACATTTGCACATAAACACTAAGG 0: 1
1: 0
2: 1
3: 37
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172496921 Original CRISPR TAGCCAACCAAATTGTGTGA TGG (reversed) Intronic
902755331 1:18545660-18545682 TAGCCAAGCAAAGTGAGTGCTGG - Intergenic
904343959 1:29856123-29856145 TACCCAAACAAAATGTGTCAGGG + Intergenic
904867523 1:33592552-33592574 TAGCTAATCATATTGTGTTAAGG + Intronic
905704590 1:40045288-40045310 TCCCCAACTAAATTCTGTGAGGG + Intronic
906986796 1:50691557-50691579 TAGCCATCCTAGTGGTGTGAAGG + Intronic
909254777 1:73406305-73406327 TAGCCAATCAAAATGTGTGAGGG - Intergenic
918254125 1:182732899-182732921 TAGCCAGCCAAATGGTATTATGG + Intergenic
918367371 1:183822547-183822569 TAGCCACCCAAAATGTTTGAGGG + Intronic
1066223462 10:33358323-33358345 AAGCCACCCAAATTCTATGAAGG - Intergenic
1090190583 11:124763861-124763883 TGGCCAAGCAGATTGTGTGGTGG + Intergenic
1107271344 13:38621098-38621120 TTGCCAGGCTAATTGTGTGATGG - Intergenic
1108546771 13:51502879-51502901 CAGCCAAGTTAATTGTGTGATGG - Intergenic
1108977535 13:56467385-56467407 TAGCAAACTAAATTATTTGATGG - Intergenic
1109316097 13:60751648-60751670 TACCCAAGCAAATTGTTTTAAGG - Intergenic
1110505474 13:76280863-76280885 TAGCCAACCATATTGAATCAAGG - Intergenic
1112118246 13:96381497-96381519 TAGGCAACCAGATAGTGTGATGG - Intronic
1116552397 14:46258114-46258136 TAGCCGGCCAAATTGTGGGTGGG - Intergenic
1119463177 14:74829206-74829228 AAGCCATCCAACTTGTCTGAGGG - Exonic
1126837603 15:52682922-52682944 CAGACAACCAACTTATGTGAAGG - Intronic
1137029791 16:35511504-35511526 TATCCAAACAAATTGTGTAAGGG + Intergenic
1147800781 17:43085527-43085549 TAGGAAAACAACTTGTGTGAGGG - Intronic
1149314756 17:55428535-55428557 TAGCCTAACAAATACTGTGAGGG + Intergenic
1149399607 17:56281796-56281818 TAGCCATTAAAATAGTGTGAGGG - Intronic
1151198448 17:72449305-72449327 CATCCAACCAAATTGTTTTATGG - Intergenic
1151294989 17:73178533-73178555 TATCCAACCAGATTTTGTGTCGG - Intergenic
1152024404 17:77799294-77799316 TAGCCAACCAAATTGTAAAATGG + Intergenic
1152646549 17:81471537-81471559 CAGCAAACCAAATTGTGAGTAGG - Intergenic
1152765052 17:82132156-82132178 TAGCCAAGAAAATTTTGTAAAGG + Intronic
1154223358 18:12477258-12477280 CACCCAACCAAACTCTGTGAAGG + Intronic
1157644816 18:49257074-49257096 CTGCCAAACAATTTGTGTGAAGG + Exonic
1166435560 19:42764203-42764225 CAGCCAACCAAAGTTTCTGAGGG - Exonic
925069682 2:956430-956452 TGCCCAACCAAGGTGTGTGAAGG - Intronic
930824576 2:55683236-55683258 TAGCCAACCAAGGTGTGTCAGGG - Intronic
938761998 2:134434318-134434340 TAACCAACCAATTTATGAGACGG - Intronic
939618621 2:144390191-144390213 TAGAAAACCAAATTGTGGGATGG - Intronic
945820379 2:214657294-214657316 TAGCCATTCAAACTGTGAGATGG + Intergenic
947576047 2:231275435-231275457 TACCCCATCAAAATGTGTGATGG - Intronic
1172496921 20:35393997-35394019 TAGCCAACCAAATTGTGTGATGG - Intronic
1175634236 20:60567229-60567251 TAGCCGACCAAAGGGTGTGGAGG + Intergenic
959813250 3:110644127-110644149 TTCCCAACTATATTGTGTGAGGG - Intergenic
962766395 3:138567647-138567669 TAGGGAAGCAAATTGTGGGAAGG - Intronic
969031024 4:4214252-4214274 TAGCCATCCTGATAGTGTGATGG - Intronic
969224199 4:5784034-5784056 TAGCCAACCAAATGGCAGGAAGG + Intronic
971257656 4:25029726-25029748 CAGCCAACACAACTGTGTGATGG + Intronic
971805881 4:31357090-31357112 AAGACAACCAAATTGTGTGGTGG + Intergenic
971894737 4:32578276-32578298 TTGCTGACCAAAATGTGTGATGG + Intergenic
972137916 4:35915933-35915955 TAGTTGACCAATTTGTGTGATGG + Intergenic
976271886 4:83238799-83238821 TAGCCAACCAAATGGCAAGAAGG + Intergenic
976904960 4:90226017-90226039 TAGCCAACCACATTGCATGATGG - Intronic
977237763 4:94528982-94529004 TAGCCAAACAGAGTGAGTGAAGG + Intronic
979086921 4:116424703-116424725 TTGCCAACCAAAATGAGTGATGG - Intergenic
979400395 4:120242533-120242555 AAGCAAACCAAAGTTTGTGAAGG + Intergenic
979529023 4:121749126-121749148 TAGCTAACCAAATTGAGTCTAGG + Intergenic
980884595 4:138748515-138748537 TACCAAACCAAATAATGTGATGG + Intergenic
983876103 4:172876041-172876063 TAGCCATAAATATTGTGTGAGGG - Intronic
988167331 5:27610926-27610948 AAGCCAAACAAATTGTGACAGGG + Intergenic
990944071 5:61231622-61231644 TAGCAAACCAGAATTTGTGAGGG + Intergenic
994409846 5:99393072-99393094 GAGCCAACAAGATTGTTTGATGG + Intergenic
1006107677 6:31726435-31726457 TAGCCAGGCAGATAGTGTGAAGG - Intronic
1007961247 6:45961679-45961701 TTGCCAACCAAATTATTGGAAGG - Intronic
1008677091 6:53830756-53830778 TAACCAACCTAATTGTATAAGGG - Intronic
1009372653 6:62926491-62926513 TAGCCAACAGAATTTGGTGAAGG - Intergenic
1014522065 6:122456592-122456614 TAGCCAACCAAAATGTTACAAGG + Exonic
1014916156 6:127151288-127151310 TAGACAAACAACTTGTCTGAGGG - Intronic
1017947892 6:159110468-159110490 TTGCAAACAAAATTGTGAGAAGG + Intergenic
1020617117 7:10473394-10473416 TACGCAAACAAAATGTGTGATGG + Intergenic
1021877976 7:25066256-25066278 TAGCTATCCAAAATCTGTGAGGG + Intergenic
1028945636 7:96576678-96576700 TAGCCAAGTAAATTGAATGATGG - Intronic
1029022448 7:97379036-97379058 TAGCCAACCAAACTGTGCTTAGG + Intergenic
1032313233 7:130808479-130808501 TTGCCAACTAAAATGTGTCATGG - Intergenic
1032376146 7:131419933-131419955 TAACAAAACAAATTGAGTGAAGG + Intronic
1032638983 7:133743753-133743775 AAGCCACACACATTGTGTGAAGG + Intronic
1033489579 7:141829022-141829044 TATCCAACCAATTTATGTGAGGG - Intergenic
1037924232 8:22832080-22832102 TAGCAGACCAATTCGTGTGAGGG + Intronic
1040395739 8:46998639-46998661 GAGCAAACAAAATTGGGTGAAGG - Intergenic
1042892267 8:73625846-73625868 TAGCCTACCAAATTTTGTAAAGG + Intronic
1045694439 8:104792691-104792713 TAAACAACCAAATGTTGTGAGGG - Intronic
1045827402 8:106414992-106415014 TAGCAAACCAATTACTGTGAGGG + Intronic
1047950779 8:129932947-129932969 TAGCCACCCAAATGGTGGGTTGG + Intronic
1057841563 9:98489708-98489730 GGGCCATCCCAATTGTGTGATGG - Intronic
1058655326 9:107215540-107215562 TGGTCAACCACATTCTGTGAAGG + Intergenic
1186324497 X:8464535-8464557 TAGACCCCCACATTGTGTGAAGG + Intergenic
1187293733 X:17979172-17979194 TTGACAACCAGAATGTGTGAAGG - Intergenic
1187786615 X:22895400-22895422 TACCCAACGAATATGTGTGAAGG + Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1189742490 X:44134268-44134290 TAGACAACCAGAAAGTGTGAGGG + Intergenic
1194236658 X:91392586-91392608 TGGCCAAAGAAAGTGTGTGAGGG + Intergenic
1194710082 X:97225867-97225889 TTGCCAACAAAATTATGTGCAGG - Intronic
1199223905 X:145349323-145349345 TAGCCAACTAATTTGTGACAGGG + Intergenic
1200507710 Y:4035317-4035339 TGGCCACCCAAATTGTGGGTGGG + Intergenic