ID: 1172498746

View in Genome Browser
Species Human (GRCh38)
Location 20:35409646-35409668
Sequence GAGCCTGGACATTTGATCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 119}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172498746 Original CRISPR GAGCCTGGACATTTGATCAG TGG (reversed) Intronic
900784929 1:4643113-4643135 GGGACTTGATATTTGATCAGAGG + Intergenic
900804689 1:4759728-4759750 GAGCCTTGCCATTTGTTTAGAGG + Intronic
901680738 1:10911317-10911339 GAGCCTGGACAGATGCGCAGGGG + Intergenic
902130991 1:14260355-14260377 TGGTCTGGACATTTGAGCAGAGG + Intergenic
903763212 1:25713748-25713770 CAGCCTGCACAGGTGATCAGAGG + Intronic
904638397 1:31902594-31902616 GAACCTGGACATTTGAGGGGGGG + Intergenic
906097077 1:43231286-43231308 GAGCCTTGAAATTTGACCAAAGG + Intronic
908394474 1:63712948-63712970 GAACCAGGACATTTTGTCAGTGG - Intergenic
913381066 1:118210624-118210646 GAGCCTGGAGATTTGCACATAGG - Intergenic
915587902 1:156854274-156854296 CAGCCTGGATATTCGCTCAGAGG - Exonic
920067585 1:203279970-203279992 GAGACTGGACATTTTAAAAGAGG - Intergenic
922192506 1:223331876-223331898 CAACCTGGACATTTCATCATTGG - Intronic
1069785170 10:70983217-70983239 GACACTGGACATGTGGTCAGAGG - Intergenic
1070766093 10:79057193-79057215 GAGCCTGGACATGGGTCCAGGGG + Intergenic
1074412618 10:113241485-113241507 AACCCTGGAGATTTAATCAGGGG - Intergenic
1076787893 10:132760132-132760154 GAGGCTGGGCATGTGAGCAGAGG - Intronic
1077700073 11:4433011-4433033 GATCATGCACAATTGATCAGTGG + Intergenic
1079553518 11:21730873-21730895 GAGCCTGGTCATTGAATCATAGG - Intergenic
1084512626 11:69615727-69615749 GAGCCTGGACTCTGGACCAGGGG + Intergenic
1086024288 11:82271148-82271170 GAGGCAGGACAATTCATCAGTGG + Intergenic
1089156346 11:116405857-116405879 AAGCCTGGACAAAAGATCAGTGG + Intergenic
1089492632 11:118893474-118893496 GAAACTTGACATTTGGTCAGTGG + Intronic
1091991493 12:4959693-4959715 GAGCTTGGACATCTGGGCAGTGG - Intergenic
1094142808 12:27198397-27198419 GATCCTGGAGCTGTGATCAGGGG - Intergenic
1095156545 12:38863340-38863362 GAGTCTGGACATTTCATTATAGG - Intronic
1101987951 12:109462040-109462062 GATCCTGGGCCTTGGATCAGTGG + Intronic
1104771909 12:131368986-131369008 GGACCTGGACATTTGCTCTGGGG + Intergenic
1106202280 13:27549455-27549477 GAGCGAGGACTTTTGCTCAGTGG + Intronic
1114256061 14:21002194-21002216 TAGCCTGGACATGTTATCGGTGG - Intergenic
1121415024 14:93773547-93773569 GAGTCTGGGCACTTGACCAGGGG - Intronic
1124432533 15:29619771-29619793 GAGCCTGGTGATGAGATCAGGGG - Intergenic
1125352315 15:38780860-38780882 AAGGCTGGACAATGGATCAGTGG - Intergenic
1126111077 15:45175162-45175184 GAGCCTGGAAAGCTGCTCAGAGG + Intronic
1129034347 15:72640603-72640625 GAGCATGGACATGGGAACAGGGG + Intergenic
1129215535 15:74096613-74096635 GAGCATGGACATGGGAACAGGGG - Intergenic
1129417205 15:75392016-75392038 GATCATGGACACTTGGTCAGTGG - Intronic
1130556084 15:84923526-84923548 GAGCTTGGGCATTGGATGAGGGG - Intronic
1131353117 15:91719437-91719459 GAGCCTGGGCCTTGCATCAGAGG + Intergenic
1132163096 15:99561754-99561776 GAGACTGGACATGTTAGCAGGGG - Intergenic
1135294551 16:21267882-21267904 GAGAATGGACATTTGATCAGGGG + Intronic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1136714673 16:32268963-32268985 GAGCCAGGACTTTTTATCATGGG + Intergenic
1139364743 16:66426705-66426727 TAGGCTGGGCATTTGAGCAGGGG - Intergenic
1140990238 16:80203899-80203921 GAGCCTGGAATTTGGAACAGGGG - Intergenic
1141216863 16:82033228-82033250 GAGTCTTGGCATTTGGTCAGTGG - Intergenic
1141285157 16:82664568-82664590 GAGCCTTTACATTTGATGACTGG + Intronic
1203055378 16_KI270728v1_random:920806-920828 GAGCCAGGACTTTTTATCATGGG - Intergenic
1143569181 17:7744074-7744096 AAGCATGGACATTTTATGAGTGG - Intronic
1143722618 17:8823325-8823347 GAGCCTGGGTATTTAATCGGTGG + Intronic
1144767813 17:17742258-17742280 GAGCCTGGAACCATGATCAGAGG - Intronic
1145010236 17:19363840-19363862 GAGCAAAGATATTTGATCAGGGG + Intronic
1147865453 17:43549046-43549068 GAGCCTGGACATTCAATCAGAGG - Intronic
1150372293 17:64650536-64650558 GTGCCTGGTCATTTTATGAGAGG - Intronic
1152113993 17:78373617-78373639 GAGGCTGGACATATGACCAAGGG + Intergenic
1153423042 18:4930121-4930143 CAGCCTGGACATTTCAGCAAAGG + Intergenic
1155724827 18:29067912-29067934 CAGCCTGGATTTGTGATCAGAGG - Intergenic
1156159944 18:34347348-34347370 GAGACTGAACATTTGACCACAGG - Intergenic
1157936624 18:51880756-51880778 GAGACTGTACACTTGATCAAAGG - Intergenic
1159749563 18:72283472-72283494 GACCCTGTCCATTTGGTCAGGGG + Intergenic
1160226067 18:77011980-77012002 AAGTCTGGACATTTGATAACAGG - Intronic
1160691577 19:462659-462681 GAGACTGGACATTTGTCCTGGGG - Intergenic
1161570237 19:5026594-5026616 GGGCCTGCACATTTGCTCAGCGG + Intronic
1162502030 19:11059638-11059660 GCCCCTGGACAGCTGATCAGTGG - Intronic
1162834668 19:13308380-13308402 GTTCCTGGACATTTGTACAGGGG - Intronic
1164056665 19:21627832-21627854 GAGCCTGGAAAATGGAACAGAGG - Intergenic
1165560105 19:36671750-36671772 GAGACTGAACATTTAATCATGGG + Intergenic
929542476 2:42833039-42833061 GAGCCTGCACATGTAACCAGTGG + Intergenic
932708054 2:74042123-74042145 GAGCATGGTCATTTAACCAGTGG + Intronic
933197443 2:79408223-79408245 GAGCCTGGACCTTTGACATGTGG + Intronic
936386248 2:112032271-112032293 GAGCCAGGCCATATGGTCAGAGG + Intergenic
937006956 2:118525625-118525647 GAGACTGGACACTTAATCATGGG + Intergenic
944970692 2:204989391-204989413 GAGCCAGGACATTTTACTAGAGG + Intronic
946882294 2:224188569-224188591 GATCCTACACACTTGATCAGAGG + Intergenic
946972135 2:225105828-225105850 GTGCCTGGAGACTTGAACAGAGG - Intergenic
947501247 2:230672814-230672836 CCGTCTGGACATTTGCTCAGGGG - Intergenic
948467610 2:238159749-238159771 GAGCCTGGACTGCTGAGCAGAGG + Intronic
1171362821 20:24601423-24601445 GAGCCTGGACTTCTCATCATAGG + Intronic
1172498746 20:35409646-35409668 GAGCCTGGACATTTGATCAGTGG - Intronic
1173865761 20:46311768-46311790 GAGCCTGCAGGTTTGAGCAGGGG + Intergenic
1174180737 20:48672729-48672751 GAGGAGGGACATTTGAGCAGAGG - Intronic
1176044523 20:63085473-63085495 GAGGCTGGACATCTGAGCAGCGG + Intergenic
1181023614 22:20115839-20115861 GAGCCTGGACATTTGGGGAGTGG - Intronic
1183108220 22:35629776-35629798 GCGCCTGTGTATTTGATCAGTGG - Intronic
949693412 3:6666859-6666881 GAGACTGGATATTTTATAAGAGG - Intergenic
950903226 3:16515093-16515115 GCGCAGGGACATTTGCTCAGGGG + Intergenic
951403489 3:22264388-22264410 AAGCCAAGACAATTGATCAGTGG + Intronic
953500954 3:43433724-43433746 GAGCCTATACATCTGAACAGCGG - Intronic
954414974 3:50388839-50388861 AAGCCTGCACATTTGGCCAGTGG - Intronic
954863874 3:53712683-53712705 GAGGCTGGACAACTGAGCAGTGG - Intronic
955786427 3:62545199-62545221 AAGCTTTGACATTTGATCAATGG - Intronic
956886933 3:73569719-73569741 GCGCCTGGACCTTTGGCCAGGGG - Intronic
963363515 3:144305376-144305398 GAGCCTGGAAGAATGATCAGTGG + Intergenic
971336595 4:25728898-25728920 GAGTCTGTTCAGTTGATCAGGGG - Intergenic
981272181 4:142857932-142857954 GAGCATGGACATCTGATCTAAGG - Intergenic
981580838 4:146247113-146247135 GAGCCTGGGAATTAGAGCAGAGG + Intergenic
983216613 4:165008084-165008106 GTGCCTGGACAGTGGATCAGAGG + Intergenic
983890924 4:173029204-173029226 AATCCTGGACATGTGGTCAGAGG + Intronic
987400084 5:17466106-17466128 GAGCCTGAACGTGTTATCAGGGG + Intergenic
990604745 5:57397221-57397243 TAGCCTGGCAGTTTGATCAGAGG + Intergenic
993547434 5:89229941-89229963 GGGCCTGGAGCTTTGATCTGTGG + Intergenic
1000115430 5:158149197-158149219 GGACCTGGACATTTGATCATGGG + Intergenic
1000373860 5:160561294-160561316 GAGGCTGTACTTTTGATCACGGG - Intergenic
1005187199 6:23176305-23176327 AAGCCAGGTCATTTCATCAGGGG - Intergenic
1006263327 6:32894878-32894900 GAGCCTGGATACTTGAACAGAGG + Intergenic
1007840873 6:44714944-44714966 GAGCCTGGGCATTTGGGCAAAGG + Intergenic
1009567247 6:65324696-65324718 TAACCTGGACTTTGGATCAGAGG + Intronic
1014999555 6:128198296-128198318 GAGGCTGGACAGATGAGCAGGGG - Intronic
1016886342 6:148963266-148963288 GTGCCTGGACATTCTGTCAGGGG - Intronic
1021233938 7:18119587-18119609 GAGCTTAGCCAGTTGATCAGAGG + Intronic
1024758734 7:52568369-52568391 GAGGCTGGAAGTGTGATCAGAGG + Intergenic
1025281314 7:57627908-57627930 GAGCCTGGACTTTTCACCTGGGG + Intergenic
1025303415 7:57837599-57837621 GAGCCTGGACTTTTCACCTGGGG - Intergenic
1029954890 7:104627813-104627835 TAGCCTGGCAGTTTGATCAGAGG - Intronic
1031183263 7:118443799-118443821 GAGACTGGAAAAATGATCAGAGG + Intergenic
1033550640 7:142444360-142444382 GAGTCTGGACACATTATCAGGGG + Intergenic
1035085383 7:156253467-156253489 AAACATGGACATTTGTTCAGCGG - Intergenic
1040757008 8:50788851-50788873 AAACCTGGACAATTGATCTGAGG - Intronic
1041403834 8:57474065-57474087 GAGGCTGGCCCTTTGATCACAGG - Intergenic
1043743235 8:83841014-83841036 GTGACTGGACACTTGACCAGTGG - Intergenic
1044463818 8:92480644-92480666 GAGCCTGAAGATTTGGTCAGAGG + Intergenic
1046767357 8:118084119-118084141 GAGCTTGGTGATTAGATCAGTGG - Intronic
1052440000 9:28484028-28484050 CAGCCTGGGCATTTAATTAGGGG + Intronic
1055269892 9:74546088-74546110 GAGCTTTGGCATCTGATCAGTGG + Intronic
1060763318 9:126274587-126274609 GAGACTGGAGATTTCATTAGAGG + Intergenic
1187051708 X:15702747-15702769 GAGCCCTGACATTTGATCTCTGG + Intronic
1190886411 X:54534362-54534384 GAGCTTGGACAATTGATCCCAGG + Intronic
1194388443 X:93286913-93286935 GAGCCTGGTGATTTGATCATGGG - Intergenic
1194626621 X:96233204-96233226 GAACCTGAACATTTGACCATGGG + Intergenic
1197449062 X:126588555-126588577 GAGCCTGGAAAGATGATGAGGGG - Intergenic
1199264727 X:145817640-145817662 CAGCCCGGATATTTGATCTGTGG + Intergenic