ID: 1172502469

View in Genome Browser
Species Human (GRCh38)
Location 20:35437169-35437191
Sequence TCTGGCCCGGGGTGGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 0, 3: 29, 4: 259}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172502469_1172502476 0 Left 1172502469 20:35437169-35437191 CCAGACACCCACCCCGGGCCAGA 0: 1
1: 0
2: 0
3: 29
4: 259
Right 1172502476 20:35437192-35437214 TGCACACAGTGTCTCCCACCAGG 0: 1
1: 0
2: 0
3: 20
4: 221
1172502469_1172502478 11 Left 1172502469 20:35437169-35437191 CCAGACACCCACCCCGGGCCAGA 0: 1
1: 0
2: 0
3: 29
4: 259
Right 1172502478 20:35437203-35437225 TCTCCCACCAGGGCAGTGCCAGG 0: 1
1: 0
2: 0
3: 41
4: 306
1172502469_1172502479 12 Left 1172502469 20:35437169-35437191 CCAGACACCCACCCCGGGCCAGA 0: 1
1: 0
2: 0
3: 29
4: 259
Right 1172502479 20:35437204-35437226 CTCCCACCAGGGCAGTGCCAGGG 0: 1
1: 0
2: 4
3: 40
4: 379
1172502469_1172502477 1 Left 1172502469 20:35437169-35437191 CCAGACACCCACCCCGGGCCAGA 0: 1
1: 0
2: 0
3: 29
4: 259
Right 1172502477 20:35437193-35437215 GCACACAGTGTCTCCCACCAGGG 0: 1
1: 0
2: 0
3: 13
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172502469 Original CRISPR TCTGGCCCGGGGTGGGTGTC TGG (reversed) Intronic
900376748 1:2358311-2358333 TCTGGGCCTGGGTCCGTGTCTGG - Intronic
900529996 1:3148422-3148444 GCTGGGCTGGGCTGGGTGTCAGG + Intronic
901039698 1:6356475-6356497 GCTGGCCAGGTGTGGGTGGCAGG - Intronic
901666663 1:10830165-10830187 TCACGCCCGGAGTGGGTGGCGGG - Intergenic
901675288 1:10879898-10879920 CCTTGCCCGGGGTGTGTGTTGGG + Intergenic
902231776 1:15032110-15032132 TCTGCCTCGGGCTGGGTGTGGGG - Intronic
904300338 1:29549872-29549894 CCTGGCACAGGGTTGGTGTCTGG + Intergenic
904701776 1:32362172-32362194 TCTGGCCCGCGCTGAGTGCCAGG - Exonic
905405998 1:37732762-37732784 ACTGGACCTGGGCGGGTGTCTGG - Intronic
905833795 1:41098765-41098787 GCTGGCGGGGGGTGGGGGTCGGG - Intronic
906056922 1:42924764-42924786 TCTGGGCCGGGGCGGGGCTCGGG + Intergenic
907280532 1:53344241-53344263 TCTGGTCCGGGTTGGGGGTTTGG - Intergenic
910728137 1:90360220-90360242 TCTGGGCCTGTGTGGGTATCTGG - Intergenic
911017106 1:93345634-93345656 TCTGGGAAGGGGTGGGTGGCTGG - Intergenic
911050647 1:93668122-93668144 TCTGTCCTGGGGTGGGAGTGAGG + Intronic
912502160 1:110129857-110129879 TCTGGGCAGGGGTGGGAGTGGGG + Intergenic
915477767 1:156163068-156163090 CCTGGCCGGGGGTTGGTCTCAGG - Exonic
915599502 1:156913513-156913535 TCTGGACAGGGGTAGGTGCCGGG + Exonic
916412416 1:164559316-164559338 TCTGGCCCGGAGTGGGGGTGGGG + Intronic
920123668 1:203676797-203676819 TCTGGCTTGGGGTGGGGGTGGGG + Intronic
922717976 1:227886875-227886897 TCAGCGCCGGGGTGGGGGTCGGG - Intergenic
922725059 1:227918820-227918842 TCTGGCCAGGTGTGGGTGGGTGG - Exonic
923219975 1:231884001-231884023 CCTTGCCCAGGGTGGGTGGCAGG + Intronic
923291166 1:232547558-232547580 TGTGGCCCGGGGTGGGGGCTGGG + Intronic
924615209 1:245606660-245606682 TTTGGCCGGGTGTGTGTGTCTGG - Intronic
924769446 1:247066282-247066304 TCTGGCCCTGGGTGGTTCCCAGG + Intronic
1063286658 10:4695861-4695883 TCTGGCTTGGGCTGGGGGTCTGG + Intergenic
1065025388 10:21535109-21535131 TCTGGGCCGGGGTGGGGGCGGGG + Intronic
1067065229 10:43100736-43100758 TGGGGCACGGGGTGGGTGTTGGG - Intronic
1067848129 10:49738897-49738919 TCTGGGCCAGGCTGGGTGTGGGG - Intronic
1068968357 10:62936272-62936294 TTTGGCGGGGGGGGGGTGTCAGG + Intergenic
1069601730 10:69712330-69712352 TCTGGGCAGGGGTGGGTGAGAGG - Intergenic
1069825181 10:71250384-71250406 TCTGGCCTGGCTTGGGTGTGTGG + Intronic
1069959145 10:72069360-72069382 GCTGGCTTGGGGTGGGTGCCAGG - Intronic
1071095723 10:81972001-81972023 CCTGGCCCAGTGTGAGTGTCAGG - Intronic
1072421180 10:95291287-95291309 TCGGGCCCGGGGCGGGTGCTAGG + Intergenic
1073081725 10:100864878-100864900 TCTGGCCCTGGTTGGGGGTGGGG - Intergenic
1073531911 10:104240021-104240043 CCAGGCCCGGTGTGGGGGTCAGG + Intronic
1073531966 10:104240419-104240441 TCTGGCACGGTGTAGGGGTCAGG - Intronic
1074361875 10:112830274-112830296 CCTGGCCAGGGGTAGGCGTCAGG - Intergenic
1074509798 10:114101642-114101664 CCTAGCCCTGTGTGGGTGTCGGG - Intergenic
1074976387 10:118585312-118585334 TCTGGAGGTGGGTGGGTGTCAGG - Intergenic
1075575680 10:123575792-123575814 TCAGGCCAGGGGTGGGTGGGAGG + Intergenic
1077008395 11:369597-369619 GCGGGCCCGGGGTGGGCGGCGGG - Intergenic
1077080547 11:722877-722899 TCTGGGGAGGGGTGGGTGTCAGG - Intronic
1077080564 11:722914-722936 ACTGGGGAGGGGTGGGTGTCAGG - Intronic
1077080580 11:722952-722974 TCTGGGGAGGGGTGGGTGTCGGG - Intronic
1077080598 11:722990-723012 TCTGGGGAGGGGTGGGTGTCGGG - Intronic
1077147959 11:1054235-1054257 TCTGGCCCGGGGGAAGTGCCTGG - Intergenic
1077504110 11:2922306-2922328 GCTGGCCCCGGGTGGGTGTGGGG - Intronic
1077523369 11:3049496-3049518 TCTGGCCAGAGGAGGGAGTCTGG + Intronic
1078423731 11:11232979-11233001 TCTGGCTAGGTGTGGATGTCGGG + Intergenic
1080606462 11:33869066-33869088 TCTGGCCCGTGGTGGCTTTGGGG + Intronic
1081937977 11:46918092-46918114 TCTGGGCCGGGGCGCGGGTCTGG - Intronic
1082035845 11:47644688-47644710 TCTTGCCAGGGGTGGGTGGTTGG + Intergenic
1082791788 11:57350688-57350710 TCTGGGCCAGGGTGGGGGTGGGG - Intronic
1083618207 11:64036503-64036525 CCTGGCCCGTGGGGGGCGTCAGG + Intronic
1083828138 11:65214453-65214475 TCTGGCCCGCACTGGGTGGCTGG - Intergenic
1084415971 11:69033226-69033248 CCTGGCCCCGGGGGGGTGTGCGG + Intergenic
1085084330 11:73656649-73656671 CCTGGCATGGGGTGGGTGGCAGG + Intronic
1085456921 11:76670677-76670699 TCTGGCGCGGGGTGGGACCCGGG - Intronic
1089274919 11:117328183-117328205 CCGGGCCCGGGCTGGGGGTCTGG + Intronic
1089364909 11:117915589-117915611 ACTGGGCCGGGTTGGGAGTCAGG + Intronic
1089650117 11:119907477-119907499 TCTGGCCTGGACTGGGTGGCTGG + Intergenic
1089881444 11:121777365-121777387 ACTGGCCTGGGTTGGGTATCTGG + Intergenic
1092921652 12:13236990-13237012 TCTGACCCTGGGTGGGTCTTGGG - Intergenic
1093502500 12:19828331-19828353 TCTGCCCTGGAGTGGGTGCCAGG + Intergenic
1096302635 12:50445001-50445023 TCGGGCCGGGGGTGGGTGCGAGG - Intronic
1102258812 12:111431011-111431033 GCCGGCCGGGGGTGGGTGGCGGG + Intronic
1103557306 12:121774575-121774597 TGTGGCTGGGGGTGGGCGTCTGG + Intronic
1103918457 12:124387805-124387827 TCTGGCCCGGTGTGTTTGCCTGG - Intronic
1105248054 13:18670442-18670464 TCTGGCCCTGGGTGAGTACCTGG + Intergenic
1106979195 13:35256782-35256804 TCTGCCCAGGAGTGGGTGCCAGG + Intronic
1107935440 13:45341666-45341688 TCTGGCCTGGGGTAGATCTCGGG + Intergenic
1109052875 13:57507034-57507056 ACTGGCCTGGGGAGGGGGTCTGG + Intergenic
1112286815 13:98111843-98111865 GCTGGCCCTGGGCTGGTGTCTGG + Intergenic
1113611066 13:111645420-111645442 TCTCTCCCAGGGTGAGTGTCTGG - Intronic
1114063032 14:19037653-19037675 TCTGGCGCGGGGTGGGGGTGGGG + Intergenic
1114099227 14:19362342-19362364 TCTGGCGCGGGGTGGGGGTGGGG - Intergenic
1114216313 14:20660213-20660235 TCTGGGCCCGGGGGGGTGCCTGG + Intergenic
1114452797 14:22837769-22837791 TCTGGGCCGGGGTGAGGGTGGGG - Intronic
1121834124 14:97076861-97076883 GCTGGTCCGGGTTGGGTTTCAGG + Intergenic
1123496638 15:20833573-20833595 TCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1123553873 15:21407165-21407187 TCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1123590117 15:21844530-21844552 TCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1124183475 15:27500330-27500352 TCTGCCTCGGGCTGTGTGTCGGG - Intronic
1124603208 15:31151579-31151601 TCTGGCCAGGGTTTGGTGTGGGG + Intronic
1125951149 15:43753081-43753103 TCTGTCTCGGGGTGGGGGTGGGG - Intronic
1127842930 15:62846189-62846211 TCTGGCACGTGGTAGGTGTAGGG - Intergenic
1128373247 15:67056535-67056557 TCAGGCCCTGGGTGTGTGACAGG - Intergenic
1128741772 15:70088886-70088908 TCTGCCGCGGGGTGGGGGTGGGG - Intronic
1202962219 15_KI270727v1_random:134361-134383 TCTGGTTTGGGGTGGGTGGCTGG + Intergenic
1132756763 16:1489028-1489050 TTTGGCCCTGGCTGGATGTCAGG + Intergenic
1133620112 16:7518249-7518271 TCTGGCGCGGGGTGGGGATGAGG - Exonic
1135208105 16:20499604-20499626 GCTGGCCCTGGGCTGGTGTCTGG - Intergenic
1135210794 16:20524096-20524118 GCTGGCCCTGGGCTGGTGTCTGG + Intergenic
1135281768 16:21158879-21158901 TCTGCCCCGGGGTTAGTGTAAGG + Intronic
1136029580 16:27492881-27492903 TGTGGCCCTGGTTGGGTGTTAGG - Intronic
1136276073 16:29180191-29180213 TCTGGCCATGGCTGGGTGGCAGG + Intergenic
1136997175 16:35198533-35198555 TCTGGCAGGGGGTGGTTATCTGG + Intergenic
1138351077 16:56346568-56346590 TCTGGCCTGAGGAGGGTGTGGGG + Exonic
1139532351 16:67548588-67548610 TCTAGCCAGGGGTGGGTGTGAGG + Intergenic
1141422489 16:83925986-83926008 TCTGGCCCGAGGTGGCTGCAGGG + Exonic
1142081049 16:88148938-88148960 TCTGGCCGTGGCTGGGTGGCAGG + Intergenic
1143078493 17:4365480-4365502 TCTGGCCCGGGGCGGCGGCCGGG - Intronic
1143377891 17:6478143-6478165 TCTGGCCGGGTGTGGGGGTGAGG - Intronic
1144109757 17:12020717-12020739 TCTGGCCCGGGCTGCGCGTCGGG + Intergenic
1144283455 17:13749689-13749711 TCTGGCACTGGGGGGGTGTAGGG + Intergenic
1144959353 17:19036129-19036151 CCTGGCACGGGGTGGGAGGCTGG - Intronic
1144975806 17:19138395-19138417 CCTGGCACGGGGTGGGAGGCTGG + Intronic
1146518627 17:33509114-33509136 TCTGGCACAGGGTAAGTGTCTGG + Intronic
1150467226 17:65403639-65403661 TCTGGGCCTGGGTGGGAGTGGGG - Intergenic
1151293340 17:73165803-73165825 TCTGTCCCGAGGTGGGGGACGGG - Intronic
1152315594 17:79578561-79578583 CCTGGCCCGGAGCGGGTCTCAGG - Intergenic
1154440799 18:14388686-14388708 TCTGGCCCTGGGTGAGTACCTGG - Intergenic
1154490212 18:14916250-14916272 TCTGCCCTGGGATGGGTGGCAGG + Intergenic
1157332167 18:46712016-46712038 TCTGGCACAGGGTGGGGGTTGGG + Intronic
1158170277 18:54590803-54590825 TCAGTCCCTGGGTTGGTGTCTGG - Intronic
1158397750 18:57092852-57092874 TGTGGCCAAGGGAGGGTGTCAGG + Intergenic
1160227183 18:77020239-77020261 TCTGGCCTGGGGTGGGGGAGTGG + Intronic
1160531409 18:79567147-79567169 GCCGGCCAGGGGTGGGTGCCCGG - Intergenic
1160846429 19:1168178-1168200 GCTGCCCCGGGGTGGGGGTGTGG - Intronic
1161024080 19:2027159-2027181 TGTGGCCCTGTGTGTGTGTCTGG - Intronic
1161042348 19:2116862-2116884 GCTGGCCCTGTGTGGGTGGCAGG - Intronic
1161265033 19:3359998-3360020 TCTGGCCCGGGGAGGGGGCGGGG - Intronic
1161366305 19:3881687-3881709 GCTGGCAGGGGGTGGGGGTCGGG + Intronic
1161447047 19:4324258-4324280 GCTGGTCCTGGGTGGCTGTCAGG - Intronic
1161466713 19:4434979-4435001 TATGGCCAGGGGTGGGTGCCAGG - Intronic
1161471177 19:4457434-4457456 TCGGGCCGAGGGTGGGCGTCAGG - Intronic
1162035033 19:7934020-7934042 GCGGGGCTGGGGTGGGTGTCTGG + Intronic
1162140072 19:8580402-8580424 TCAGGTCAGGGGAGGGTGTCAGG + Exonic
1162550628 19:11356441-11356463 TTTGGCCTGGGGTGGGGGTGGGG + Intronic
1162553821 19:11374179-11374201 TATGGGCCGGAGTGTGTGTCTGG - Intergenic
1162794615 19:13080075-13080097 TCAGGCCCTGGGTGGGAGACTGG - Intronic
1163357181 19:16821400-16821422 TCTGGGGCGGGGTGGGGGTCGGG + Intergenic
1163420736 19:17212277-17212299 TCTGGCCCGAGGCGGGGGGCAGG - Exonic
1163860893 19:19742378-19742400 TATGGCCCAGGGTGGGTGACTGG - Intergenic
1164532231 19:29057371-29057393 TCTGGCTCGGGGTGAGTGCGAGG - Intergenic
1166151707 19:40879986-40880008 TCTGGAGCGGGGTGGGAGTTTGG + Intronic
1166344273 19:42155690-42155712 TCCGGCCTGGGGTGGGTGTGAGG - Intronic
1166427517 19:42692713-42692735 TCAGGCTGGAGGTGGGTGTCAGG + Intronic
1167047601 19:47059722-47059744 TCGGGACCGAGGTGGGTGTACGG - Intergenic
1167254981 19:48421958-48421980 TCGGGCCGGGGGTGGGGGTTGGG + Intronic
1167661178 19:50796889-50796911 TCTGGCCCTGGGAGGGAGCCTGG + Intergenic
1167709067 19:51099053-51099075 GCTGGCCCGGGGCGGGGGCCTGG - Exonic
1167781374 19:51601265-51601287 GCTGGCCCGGGGCGGGGGCCTGG + Intergenic
1168293420 19:55368159-55368181 TGGGGCCAGGGGTGGGGGTCTGG + Intronic
924958231 2:10482-10504 TCGGGTTCGGGGTGGGGGTCGGG - Intergenic
925129605 2:1485055-1485077 TCTGTCGTGGGGTGGGGGTCAGG - Intronic
927325540 2:21801085-21801107 ACTGGCCGGGGGTGGAGGTCAGG + Intergenic
929681557 2:43997336-43997358 TCTGGCACTGGGTAGGTGTATGG - Intergenic
931094120 2:58920382-58920404 TGTGGCGCGGGCTGGGTCTCTGG + Intergenic
931161980 2:59702616-59702638 TCTGGCCCAGGGTGTGTCTAGGG + Intergenic
931620676 2:64206477-64206499 TATGGCCAGGGGTGGGTGAGTGG + Intergenic
933592932 2:84252446-84252468 TCTGGCTCTGGGTGTGTGTAGGG + Intergenic
933774964 2:85766338-85766360 TCAGGCCCGGGCTGGGTGTGGGG - Intronic
934491079 2:94762349-94762371 TGTTGCCCAGGGTGGGTGGCTGG - Intergenic
934714729 2:96536950-96536972 AGGGGCCCGGGGTGGGTTTCGGG + Intronic
935263990 2:101379151-101379173 TATGCCCTGGGGTGGGAGTCAGG + Intronic
936091084 2:109501799-109501821 CCTGGCCCAGGGTGGGGGCCAGG + Intronic
937477999 2:122232052-122232074 TGTGGCCCAGGGTGGCTGTCAGG + Intergenic
937710599 2:124976300-124976322 TCTGCCCCTGGGTGGCTGGCTGG - Intergenic
938329970 2:130442377-130442399 TGCTGCCCAGGGTGGGTGTCTGG - Intergenic
938359975 2:130679126-130679148 TGCTGCCCAGGGTGGGTGTCTGG + Intergenic
938465451 2:131522010-131522032 TCTGGCCAGGAGTGGGGGGCAGG + Intergenic
938480387 2:131657816-131657838 TCTGGCGCGAGGTGGGGGTGGGG + Intergenic
942738546 2:179146006-179146028 TGTGGCCCAGGGTGGGGGTGGGG - Intronic
943446425 2:187993557-187993579 TGTGGGTCGGGGTGGGTGGCAGG - Intergenic
944537509 2:200725564-200725586 TCTGGGCAGGAGTGGGGGTCTGG - Intergenic
948048023 2:234958416-234958438 GCTCGCCCTGGGGGGGTGTCTGG + Intronic
948569007 2:238905559-238905581 CCTGGCCAGTGGTGGGTTTCAGG - Intronic
1170554783 20:17506152-17506174 GCTGGCCAGGAGTGGCTGTCAGG - Intronic
1172115593 20:32571763-32571785 GCTGGCCTGGGCTGGGTGTGGGG + Intronic
1172481571 20:35274789-35274811 TGTGCCCCAGGGTGGGTGTCTGG + Exonic
1172502469 20:35437169-35437191 TCTGGCCCGGGGTGGGTGTCTGG - Intronic
1172755552 20:37281357-37281379 CCTGGGCCGGGGTGGGGGGCGGG + Intergenic
1174213406 20:48898012-48898034 TCTGGACCGGTGGGGATGTCAGG - Intergenic
1175249144 20:57598302-57598324 TGTGCCCCGGGGTGGGCGTGGGG + Intergenic
1178925744 21:36773503-36773525 TCTGGCATGGGGTGGGTGTGAGG + Intronic
1180481525 22:15760282-15760304 TCTGGCGCGGGGTGGGGGTGGGG + Intergenic
1181274835 22:21681799-21681821 TCTGGCAGGGAGTGGGTGTAGGG + Intronic
1181794512 22:25295225-25295247 TGTGGCGGGGGGTGGGGGTCTGG + Intergenic
1182077430 22:27504598-27504620 TCTGGCACTGGGTGCCTGTCAGG - Intergenic
1182610075 22:31540178-31540200 TCTGGCACGGGGTGGGGGGGTGG + Intronic
1184110010 22:42389019-42389041 TCTGGGCCTGGGTGGGTGGAGGG - Intronic
1184640675 22:45868371-45868393 TCTGGGCTGGGGCGGGTGCCAGG - Intergenic
1184670612 22:46010684-46010706 TCTGGCCTAGGCTGGGTGCCAGG - Intergenic
1185014910 22:48337057-48337079 TCGGGCTCGGGGTGGGTGGGAGG + Intergenic
1185052387 22:48560531-48560553 CATGGCCCAGTGTGGGTGTCAGG - Intronic
1185367903 22:50445411-50445433 GCTGGGGCGGGGTGGGGGTCTGG - Exonic
1185385612 22:50530202-50530224 TCCCGCCCGGCGTGGGTCTCGGG + Intronic
950153774 3:10707792-10707814 CCTGGCCCGGCGGGGGTCTCCGG + Intronic
950238065 3:11341064-11341086 TCTGGGGCGGGGTGGGGGACGGG - Intronic
952966731 3:38625690-38625712 TCTGGCCCTGAGTGGGAGCCAGG + Intronic
954215912 3:49124413-49124435 TCTGGCCCGGCTTGGGTGGCAGG + Exonic
956791490 3:72683500-72683522 TCTGGCAGGGGGTGGGGGTGGGG + Intergenic
956959114 3:74376689-74376711 CATGGACTGGGGTGGGTGTCAGG - Intronic
958791595 3:98657466-98657488 TCAGGGCCGGGGTGGGGGTCGGG + Intergenic
959539995 3:107525795-107525817 TGTGACCCGGGCTGGGTGTTTGG + Intronic
963901049 3:150733863-150733885 TCTGACCTTGTGTGGGTGTCAGG + Intergenic
967219681 3:187237963-187237985 TCTGGCCTGGGGTGAATGGCAGG - Intronic
968653660 4:1769716-1769738 TCAGCCCCGGGAGGGGTGTCAGG + Intergenic
968830416 4:2930747-2930769 ACTGGCGGGGGGTGGGGGTCAGG + Exonic
968985217 4:3871320-3871342 ACTGTCCCGGGGTGGGAGTTAGG + Intergenic
969504828 4:7578928-7578950 TCTGGCTGTGGGTGGATGTCAGG + Intronic
969519240 4:7666182-7666204 TCTCAGCCAGGGTGGGTGTCTGG + Intronic
969711749 4:8848734-8848756 TCTGACCCAGGTTGGGTGTCAGG - Intronic
972727148 4:41754727-41754749 TGTGGCACGGGGTGGGGGTGGGG + Intergenic
973759020 4:54100411-54100433 TCCGGCCCGGGGTGCGGTTCAGG - Exonic
983253859 4:165376984-165377006 TCAGGTCTGGGGTGGGTTTCAGG - Intronic
983516584 4:168663459-168663481 TCTGGCCCTGGGTTGATGTGGGG + Intronic
985111986 4:186555494-186555516 TCCGGCGCGGCGTGGGCGTCCGG - Exonic
985604305 5:850259-850281 TCTGGCCCAGGGCAGGTGACTGG + Intronic
986442228 5:7792575-7792597 TCTGGCCCAGGGAGGCTGTCAGG - Intronic
989631043 5:43483479-43483501 TCTGGCCCAGGGTGGGGTTCCGG - Intronic
991437785 5:66614229-66614251 TGAGGCCCCGCGTGGGTGTCTGG + Intronic
995357665 5:111257997-111258019 CCTAGCACGGGGAGGGTGTCGGG + Intronic
998473477 5:142401343-142401365 TCTGGCCTGGGGCAGGTTTCTGG + Intergenic
999090537 5:148932070-148932092 TCAGGCCTGGGGAGGCTGTCAGG - Intronic
999232100 5:150067731-150067753 TCTGCCCCGTGCTGGGTGCCAGG + Intronic
1001424193 5:171612815-171612837 TCTGGGCTGGGGTGGGGGACGGG - Intergenic
1002517014 5:179766267-179766289 TCTGGCCCGGGGCTGGTGCCGGG - Exonic
1002997720 6:2302849-2302871 TCTGGCATGGGGTGGGGGTATGG + Intergenic
1003973255 6:11319229-11319251 CCTGGCCCAGGCTGGGTGCCTGG + Intronic
1005870493 6:29971431-29971453 CCTGAACCTGGGTGGGTGTCAGG - Intergenic
1005935837 6:30520419-30520441 GCTGTCCCGCGGTGTGTGTCCGG + Intergenic
1006401704 6:33821573-33821595 TCCAGCCTGGGGTGGGGGTCAGG - Intergenic
1006671275 6:35731404-35731426 TCTGGGACGGGGTGGGGGTGGGG - Intergenic
1006751516 6:36380867-36380889 TCGGGGTCGGGGTGGGAGTCAGG - Intronic
1006831419 6:36970498-36970520 CCTGGGCCGGGGTGGGTCACTGG - Intronic
1007558299 6:42783885-42783907 TCTGGCCCGGCGTGGGGGCAGGG + Intronic
1008880441 6:56375762-56375784 TGTGGCTTGGGGTGGGTGTGGGG + Intronic
1009437210 6:63632525-63632547 TCTGGCCTGGAGTGGGTATGGGG - Intergenic
1009681333 6:66897085-66897107 TCAGGCACAGGTTGGGTGTCTGG + Intergenic
1016783750 6:147988226-147988248 TCATGCCTGGGATGGGTGTCGGG - Intergenic
1017631097 6:156397184-156397206 TCTGGTCGGGGGTGGGGGTGGGG - Intergenic
1017888118 6:158616959-158616981 TCTGGCCAGGCTTTGGTGTCAGG + Intronic
1019305748 7:333565-333587 TCTGGCCCGCGGTGTGTGAGCGG + Intergenic
1019548746 7:1591938-1591960 TCTGGCTCAGGCTGGGTGGCTGG - Intergenic
1020013596 7:4818881-4818903 TCAGGCCCGTGGTGGGTGGCTGG - Intronic
1020162099 7:5780965-5780987 GCTGGCCCGGCTCGGGTGTCCGG - Intronic
1020737177 7:11965401-11965423 TCTGTCTCGGGGTGGGGTTCAGG - Intergenic
1022467554 7:30661835-30661857 TCTGGCCCGGGGTATGTGGAAGG - Intronic
1025150220 7:56541528-56541550 GCTGGCCAGGGGTGTGTGCCTGG + Intergenic
1025810217 7:64870862-64870884 TCTGGCCCAGGGTTGGCCTCAGG - Intronic
1026024055 7:66731260-66731282 GCTGGGCTGAGGTGGGTGTCAGG + Intronic
1026295389 7:69047603-69047625 TCTGTGCCTGCGTGGGTGTCTGG - Intergenic
1026735088 7:72944236-72944258 TGTGGCCAGGGTTGGGTGTTTGG + Intronic
1026785430 7:73299162-73299184 TGTGGCCAGGGTTGGGTGTTTGG + Intergenic
1027108644 7:75420771-75420793 TGTGGCCAGGGTTGGGTGTTTGG - Intronic
1028121258 7:87059140-87059162 GCTGGCCCGGAGAGGGTGTGTGG - Intronic
1029614210 7:101646063-101646085 TCTGGTCAGGGGTGGGTCACAGG - Intergenic
1031763206 7:125740485-125740507 TGTGGCCAGGGGTGGGTGTTAGG - Intergenic
1034353896 7:150435593-150435615 TTTGGGCTGAGGTGGGTGTCTGG + Intergenic
1034439715 7:151080580-151080602 CCTGGGCCGGGGTGGGTGTTGGG - Intronic
1035180630 7:157086780-157086802 TCTGTGCAGGGGTGGGTGTGTGG - Intergenic
1035180643 7:157086839-157086861 TCTGTGCAGGGGTGGGTGTGTGG - Intergenic
1035353315 7:158261580-158261602 TCTGGCTCAGGATGGGTGGCTGG - Intronic
1037495654 8:19438178-19438200 TCTTGGCCGGGGCGGGGGTCGGG + Intronic
1037850407 8:22322896-22322918 ACTGGCCTGGGGAAGGTGTCTGG - Intronic
1039051784 8:33501862-33501884 TCTGGCTTGAGGTAGGTGTCAGG - Intronic
1040323508 8:46329875-46329897 TCTGGCCCAGGGTGACTGTTTGG - Intergenic
1047179840 8:122576601-122576623 TTTGGCCAGGGGTGGGGATCAGG - Intergenic
1048843778 8:138587584-138587606 TCTGGGGCTGGATGGGTGTCAGG - Intergenic
1049537747 8:143189845-143189867 TTTGGCCCCGGGTGTTTGTCAGG + Intergenic
1055833401 9:80409868-80409890 ACTGGCCCTGGGTGGGGGTGGGG + Intergenic
1056465307 9:86848091-86848113 TCTGGCCCCAGGTGGATCTCAGG + Intergenic
1056754241 9:89372245-89372267 TCTGGGCTGTGGTGGGTGTGTGG + Intronic
1056848238 9:90058783-90058805 TCTGCCCAGGGGTGGGGTTCAGG + Intergenic
1057744675 9:97741554-97741576 TCAGCCCCGGGCTGGGAGTCAGG - Intergenic
1060199956 9:121646516-121646538 TCTGGGCAGGGGTGGGGGTGGGG - Intronic
1060220589 9:121762196-121762218 TCTGGCCCCAGGTGGCTGTGTGG + Intronic
1060591734 9:124821086-124821108 TCTGGCCCTGAGTGGGGGTCAGG - Intergenic
1060938562 9:127530158-127530180 TGTGGCCCGGCCTGGGTGTCTGG - Intronic
1061612756 9:131759040-131759062 GCTGGCCCTGGGTGGCCGTCAGG - Intergenic
1061760231 9:132846233-132846255 GAAGGCCCAGGGTGGGTGTCTGG - Intronic
1061766371 9:132884100-132884122 CCTCGGCCGGGGTGGGGGTCGGG - Intronic
1061866548 9:133494317-133494339 GGTGGCCCTGGGTGGGTGTTGGG + Intergenic
1061940841 9:133883012-133883034 CCTGGCATGGGGTGGGTGTGGGG - Intronic
1062520569 9:136956040-136956062 TCAGGCTGGGAGTGGGTGTCTGG - Intronic
1062591534 9:137276857-137276879 TCAGGCCCGGGCTGGCTGTTGGG + Intergenic
1185683205 X:1906060-1906082 TCTGGCCAGGGCAGGGGGTCAGG + Intergenic
1190245743 X:48689000-48689022 CCTGGCCCCTGGTGGGGGTCGGG + Exonic
1190524073 X:51310844-51310866 TTTGGCCAGGGGTGGGGGGCTGG + Intergenic
1195696964 X:107674446-107674468 TCTGGTCCCAGGAGGGTGTCAGG - Intergenic
1196072025 X:111535537-111535559 TCTGGCCCTCTGTGGGTGTATGG - Intergenic
1199745976 X:150772179-150772201 TCTGGCCCGGGCCAGGTGCCAGG + Intronic
1201765572 Y:17570933-17570955 TCTAGCCTGGGGTGGGTGGGGGG + Intergenic
1201835980 Y:18335056-18335078 TCTAGCCTGGGGTGGGTGGGGGG - Intergenic