ID: 1172504816

View in Genome Browser
Species Human (GRCh38)
Location 20:35454014-35454036
Sequence CCCCGGTTTAGGGATTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172504805_1172504816 16 Left 1172504805 20:35453975-35453997 CCCTGGGTACTTTCTAAAATGCA No data
Right 1172504816 20:35454014-35454036 CCCCGGTTTAGGGATTCTCTGGG No data
1172504806_1172504816 15 Left 1172504806 20:35453976-35453998 CCTGGGTACTTTCTAAAATGCAG No data
Right 1172504816 20:35454014-35454036 CCCCGGTTTAGGGATTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172504816 Original CRISPR CCCCGGTTTAGGGATTCTCT GGG Intronic