ID: 1172509364

View in Genome Browser
Species Human (GRCh38)
Location 20:35489635-35489657
Sequence CTAGTTCAGGACCCTCTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172509364_1172509366 -10 Left 1172509364 20:35489635-35489657 CCTAATAGAGGGTCCTGAACTAG 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1172509366 20:35489648-35489670 CCTGAACTAGTCAGAGAGCTTGG 0: 1
1: 0
2: 0
3: 16
4: 129
1172509364_1172509368 1 Left 1172509364 20:35489635-35489657 CCTAATAGAGGGTCCTGAACTAG 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1172509368 20:35489659-35489681 CAGAGAGCTTGGGAAAGCTTTGG 0: 1
1: 0
2: 2
3: 19
4: 267
1172509364_1172509369 8 Left 1172509364 20:35489635-35489657 CCTAATAGAGGGTCCTGAACTAG 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1172509369 20:35489666-35489688 CTTGGGAAAGCTTTGGTTGCTGG 0: 1
1: 0
2: 1
3: 10
4: 151
1172509364_1172509367 -9 Left 1172509364 20:35489635-35489657 CCTAATAGAGGGTCCTGAACTAG 0: 1
1: 0
2: 1
3: 9
4: 72
Right 1172509367 20:35489649-35489671 CTGAACTAGTCAGAGAGCTTGGG 0: 1
1: 0
2: 1
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172509364 Original CRISPR CTAGTTCAGGACCCTCTATT AGG (reversed) Intronic
909645531 1:77912617-77912639 CTATTTCTGGGCTCTCTATTCGG - Intronic
912189136 1:107317313-107317335 CTAATTCAAGACCATCTATAAGG + Intronic
917182361 1:172313721-172313743 CTAGTTCAGTACCTTCAACTGGG + Intronic
918563657 1:185899830-185899852 CTAGCACAGAACCCACTATTTGG + Intronic
919279817 1:195475198-195475220 CTATTTCTGGGTCCTCTATTTGG - Intergenic
919593623 1:199534709-199534731 CTATTTCTGGACTCTCTATTCGG + Intergenic
921691461 1:218156060-218156082 CCAGTTCAGTACTCTCCATTGGG - Intergenic
1065476902 10:26148325-26148347 CTATTTCTGGACTCTTTATTGGG + Intronic
1067917089 10:50411774-50411796 CCAGTTCAGGATTCTCTGTTAGG + Intronic
1069520158 10:69112602-69112624 CAACTTCAGAACTCTCTATTTGG + Intergenic
1077370076 11:2177659-2177681 CTGAGTCAGGACCCTCTTTTCGG - Intergenic
1080158862 11:29146609-29146631 TTATTTCTGGACTCTCTATTAGG - Intergenic
1088107304 11:106221936-106221958 CTAGTTCAGGCCTCTCATTTTGG - Intergenic
1092339289 12:7661822-7661844 CTAGTGCTGGACCTACTATTAGG - Intronic
1093600882 12:21020962-21020984 CTAATTCAGCACCATCTCTTTGG + Intronic
1094172705 12:27510579-27510601 CTAGTTTAGGATCTTGTATTAGG + Intergenic
1097227155 12:57484377-57484399 CTAGTTAGGGCCCCTCTAATGGG - Intronic
1098174212 12:67774218-67774240 CTAGGTCAGCACACTCTCTTGGG + Intergenic
1107053529 13:36078181-36078203 CTTATTCAGGACCCTCTTCTTGG - Intronic
1107613496 13:42140411-42140433 TCAGCTCAGGACCATCTATTTGG - Intronic
1111859200 13:93680274-93680296 CTATTCCAGGACCCTCTCCTTGG - Intronic
1120549407 14:85850680-85850702 CTAGTTCAGTACCCTCAAGTTGG - Intergenic
1127886326 15:63204502-63204524 CTAGTTCAATACCCTCTGTTAGG + Intronic
1131451842 15:92547792-92547814 CTAATTCAGGATCATCTATCTGG - Intergenic
1135683505 16:24478966-24478988 CTGGGCCAGGACCCTCTGTTGGG + Intergenic
1137982820 16:53084345-53084367 CCAGTTCAGGACTCTTTCTTTGG - Intronic
1142063937 16:88049509-88049531 CTAGGGCAGGACCCTCTCATGGG + Intronic
1143595156 17:7909562-7909584 CTGGGGCAGGTCCCTCTATTGGG - Intronic
1145091678 17:19991487-19991509 CCAGTACAGGAGCCTCTGTTTGG + Intergenic
1146205942 17:30905912-30905934 CTTGTTCAGGCCCCTCTCTTGGG - Intronic
1150193488 17:63268824-63268846 CTAGTTGAGGAGCCTCTTATTGG + Intronic
1154002701 18:10496739-10496761 CTATTTCTGGTCTCTCTATTCGG - Intergenic
1157936655 18:51881028-51881050 CTGGTTCAGGAACCACAATTTGG - Intergenic
1159746122 18:72237121-72237143 CTATTTCTGGACTCCCTATTGGG - Intergenic
1165127147 19:33606392-33606414 CTAGATCAGGACCCCCTTTCTGG + Intergenic
926739675 2:16101036-16101058 CAAGTTCAGGGCCCCCTGTTAGG + Intergenic
930158542 2:48129622-48129644 GGAGTCCAGGGCCCTCTATTTGG + Intergenic
930412900 2:51049101-51049123 TTATTTCTGGACACTCTATTCGG + Intergenic
936238879 2:110770097-110770119 CTAGTTCAGGCTCCTCCCTTAGG - Intronic
936289575 2:111210838-111210860 CTATTTCTGGACTTTCTATTTGG + Intergenic
941308015 2:163894419-163894441 CTAGTCCAGGACACTCATTTTGG - Intergenic
942153792 2:173106355-173106377 CTAATTCTGGACTCTCTGTTCGG - Intronic
945452494 2:210009715-210009737 CTAGGCCAGGACCCTTTCTTTGG + Exonic
946327849 2:218993838-218993860 CTAGTCCAGGCCTCTCTTTTGGG + Intergenic
947014140 2:225599422-225599444 CTAATTCATGACCTTCTGTTTGG - Intronic
948865691 2:240773670-240773692 CTAGTACATGAACCTCTATTGGG + Intronic
1172509364 20:35489635-35489657 CTAGTTCAGGACCCTCTATTAGG - Intronic
1172693989 20:36809162-36809184 CTAATCCAGGTCCCTCTGTTAGG - Intronic
1178097355 21:29230334-29230356 CTATTGCATGACCATCTATTAGG + Intronic
1180041213 21:45281189-45281211 CTAAATCAGGACCATCTAGTTGG + Intronic
1182066622 22:27435796-27435818 CTGGTTTAGGACCCTCTAGGTGG - Intergenic
1183676258 22:39300446-39300468 CTAGGGCAGGGCCCTTTATTTGG - Intergenic
960020379 3:112945388-112945410 CTATTTCTGGGCTCTCTATTTGG - Intronic
962954546 3:140252327-140252349 CTAGTTCAGGACCCTCAGCGAGG - Intronic
965518821 3:169652234-169652256 ATAGTTCATGACCTTCTTTTGGG - Intronic
970457755 4:16242259-16242281 CTAGTTCAGGAAAATCTATCTGG - Intergenic
971075246 4:23140618-23140640 CGAGTTCAGGAACCTCTAGTAGG + Intergenic
971317090 4:25576629-25576651 CTATTTCAGTAGCCTCTAATTGG + Intergenic
972105029 4:35473632-35473654 CTACTTCAGGACTTTCTTTTTGG + Intergenic
978419340 4:108513328-108513350 CTTGTTCAGCACCATCTACTGGG + Intergenic
984503540 4:180589025-180589047 CTAGATCAGCACCATCTAATTGG + Intergenic
986620935 5:9673713-9673735 CCAGTTCAGATCCCTCTCTTGGG + Intronic
987680793 5:21133616-21133638 CTAGTAGAGGGCCCTCTATGAGG - Intergenic
987789620 5:22548536-22548558 CTAGTTCACCAACCTCTTTTTGG - Intronic
989075419 5:37560371-37560393 CTAGTTCAGCTCCTTCTGTTAGG + Intronic
989661643 5:43805438-43805460 TTAGTTCAGGATTCTGTATTGGG + Intergenic
994910441 5:105898624-105898646 CTAGTTCAGCCCCCTCCTTTAGG + Intergenic
1005868975 6:29959010-29959032 ATAGTTTAGGACCATCTCTTTGG + Intergenic
1007551411 6:42732741-42732763 ACAGTGCAGGACCCTCTCTTTGG + Intergenic
1010017913 6:71125728-71125750 CAAGTTCAGGAAACTCTGTTGGG - Intergenic
1015593340 6:134843298-134843320 ATAGGGCAGGACCCTCTTTTGGG - Intergenic
1016372736 6:143391729-143391751 CTATTTCAGGACTCTCTCTTTGG + Intergenic
1020380379 7:7538228-7538250 CTAATTCAAGACCATCTGTTGGG - Intergenic
1028156244 7:87433040-87433062 CTATTTCTGGACTCTCCATTTGG - Intronic
1028967697 7:96820970-96820992 CTAGTTCAGGAGCTTTTATTGGG + Intergenic
1031373174 7:120992828-120992850 GTAGTACAGAACCCTCCATTAGG - Intronic
1032903551 7:136338259-136338281 GTAGTTCAGGACCCTGGATCAGG - Intergenic
1036674621 8:10819718-10819740 CTAGATCAGCACCATCTATAAGG - Intronic
1043359993 8:79461058-79461080 CTAGTTCCTGACCCCCTTTTGGG - Intergenic
1046895564 8:119468311-119468333 TTATTTCTGGACTCTCTATTTGG - Intergenic
1051981144 9:23019074-23019096 CTAATTCTGGGCTCTCTATTCGG + Intergenic
1186154020 X:6707183-6707205 CTAGTGAAGGACCCTCTAGTAGG - Intergenic
1193853619 X:86571254-86571276 CTATTTCTGGACCCTCTATTAGG + Intronic