ID: 1172511377

View in Genome Browser
Species Human (GRCh38)
Location 20:35503485-35503507
Sequence ATGCAGGAACGGGCAGAGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 442}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172511371_1172511377 5 Left 1172511371 20:35503457-35503479 CCGGGAGCTGACCACTCAGAGGC 0: 1
1: 0
2: 1
3: 25
4: 225
Right 1172511377 20:35503485-35503507 ATGCAGGAACGGGCAGAGGAAGG 0: 1
1: 0
2: 4
3: 41
4: 442
1172511369_1172511377 21 Left 1172511369 20:35503441-35503463 CCTTGAGAGAGCGAGGCCGGGAG 0: 1
1: 0
2: 3
3: 22
4: 201
Right 1172511377 20:35503485-35503507 ATGCAGGAACGGGCAGAGGAAGG 0: 1
1: 0
2: 4
3: 41
4: 442
1172511372_1172511377 -6 Left 1172511372 20:35503468-35503490 CCACTCAGAGGCAGCTGATGCAG 0: 1
1: 0
2: 2
3: 26
4: 224
Right 1172511377 20:35503485-35503507 ATGCAGGAACGGGCAGAGGAAGG 0: 1
1: 0
2: 4
3: 41
4: 442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172511377 Original CRISPR ATGCAGGAACGGGCAGAGGA AGG Exonic
900380406 1:2381359-2381381 CTGCAGGCACGGGCAGACCATGG - Intronic
900485259 1:2919750-2919772 AGGCGGGAACAGGCAGAGTAAGG + Intergenic
900565758 1:3331146-3331168 ATGGAGGCCAGGGCAGAGGAAGG - Intronic
900825074 1:4919860-4919882 ACGCAGTAACAGGCAGAGGTTGG - Intergenic
900831153 1:4966600-4966622 GTGCAGGCACAGGCAGAAGAAGG + Intergenic
901737328 1:11320621-11320643 CTGCAGGCATGGGCAGAGGAGGG - Intergenic
901761789 1:11476760-11476782 AAGCAGGCGCGGGCAGGGGAAGG + Intergenic
901897859 1:12330001-12330023 ATGAAGGAAAGGGCAGGGGTGGG + Intronic
902032188 1:13430961-13430983 GTGCAGGACAGGGCAAAGGAAGG + Intergenic
903011070 1:20330786-20330808 ATGCAGAAAGGGACAGAGCATGG - Intronic
904828154 1:33289027-33289049 ACACAGGAGCGGGCAGAGGCAGG + Intronic
905150180 1:35921081-35921103 GTGCAGGACAGTGCAGAGGAGGG - Exonic
905266462 1:36757321-36757343 AAGTAGGATTGGGCAGAGGAAGG + Intergenic
905544557 1:38787254-38787276 AAGAAGGAACGGGCAAGGGAAGG + Intergenic
906518830 1:46455603-46455625 ATGAGGGCACGGGTAGAGGAGGG - Intergenic
906965387 1:50451471-50451493 AGGCAGGAAGTGGCAGAGCAAGG + Intronic
908156337 1:61357498-61357520 ATGAAGGAAAGGGCAGAGGCAGG - Intronic
908784679 1:67723233-67723255 ATGAAGAAAAGTGCAGAGGATGG + Intronic
910021983 1:82602686-82602708 AAGCAGGATTGGGCAGAGGGAGG + Intergenic
911256268 1:95637074-95637096 ATGCAGGGACAGGAAGAGCATGG - Intergenic
911871793 1:103108422-103108444 AGGCAGGGCCCGGCAGAGGAAGG - Exonic
912460220 1:109825475-109825497 ATGCAGAAACAGGCAGAGAGAGG + Intergenic
912794983 1:112687897-112687919 GTGCAGGGAGGGGCAGAGGGGGG - Intronic
915564931 1:156707891-156707913 ATGCAGGGACAGTCATAGGAGGG + Intergenic
916224755 1:162478489-162478511 ATGAAGGAAAGGGAAGGGGAAGG + Intergenic
916276972 1:163004922-163004944 ATGCAGGAAAGGCTCGAGGAGGG + Intergenic
916310039 1:163388127-163388149 ATGCAGCAACGAGCTGAGAAAGG - Intergenic
917164750 1:172099364-172099386 ATGCAGGAGAAGGCAGAGAAGGG - Intronic
917629636 1:176879281-176879303 AGGCAGGAACAGGCAGAGCAGGG - Intronic
919869661 1:201810817-201810839 AGGCAGGAAGGGGCCGAGGAAGG - Intronic
919979232 1:202632050-202632072 CTGCAGGAAGGGGCTGAGGTGGG + Intronic
920839087 1:209538783-209538805 ATCCAGGAAGAGGCAGAGTAGGG + Intergenic
921087259 1:211806531-211806553 ATGGAGGAAGGGGGAAAGGATGG + Intronic
921217855 1:212951938-212951960 AGGAAGGAATGGGGAGAGGAAGG - Intronic
922067013 1:222154169-222154191 GTGCAGGCTCTGGCAGAGGAAGG - Intergenic
922226608 1:223650937-223650959 GTGCTGGAACGAGCAGTGGAGGG + Intronic
922532893 1:226357849-226357871 CTGCAGCAATGTGCAGAGGAGGG - Intergenic
923783120 1:237042866-237042888 CTGCGGGAACCGGGAGAGGAGGG + Intronic
1063278401 10:4597188-4597210 ATGCAGGAGCAGGGTGAGGAGGG - Intergenic
1065120514 10:22525787-22525809 ATGCAGCAACTTGCAGAAGAGGG - Intergenic
1065120885 10:22529733-22529755 ATGCAGCAACTTGCAGAAGAGGG - Intergenic
1066695654 10:38075500-38075522 CTGGAGGAATGGGCAGAGCAGGG + Intergenic
1067692351 10:48509819-48509841 ATGGAGGAGGGGGCACAGGAAGG + Intronic
1068106167 10:52619579-52619601 AAGCAGCAATAGGCAGAGGAAGG + Intergenic
1068838804 10:61587321-61587343 TTGCAGGACCAGGCAGAGGCTGG + Intergenic
1068874304 10:61980189-61980211 ATGGAGGAAGGGGCTCAGGAGGG + Intronic
1069705450 10:70456569-70456591 AGGCAGGTACAGGCAGAGAAAGG - Intergenic
1069950343 10:72014367-72014389 CTGCAGGAAGAGGCAGAGGAGGG + Intergenic
1070387793 10:75941565-75941587 ATGCAGGAAGGGGATCAGGATGG - Intronic
1070645864 10:78202068-78202090 ATGCATGAACGTCCAGAGGCAGG + Intergenic
1075097292 10:119480826-119480848 ATACAGGAAGGGGCAGAAGAGGG - Intergenic
1076209961 10:128632439-128632461 ATGCAGGAGTGGGCAGGGGAGGG + Intergenic
1076476446 10:130756997-130757019 CTGCAGGAAAGGAAAGAGGAAGG + Intergenic
1076494294 10:130886755-130886777 ATGGAGGAACAGGCAGGTGAGGG - Intergenic
1076564105 10:131386546-131386568 ATGGAGGAATGAGCAGAGGGAGG + Intergenic
1076810490 10:132884125-132884147 AAGCAGGAAGGGCCTGAGGAGGG - Intronic
1077022358 11:423462-423484 TTGCTGCAAGGGGCAGAGGAAGG - Intronic
1078357019 11:10640038-10640060 ATGAAGGAATGGGGAGAGAAGGG + Intronic
1080110094 11:28557051-28557073 ATGCAGAATTGGGAAGAGGAGGG - Intergenic
1080600933 11:33820089-33820111 CTGCAGGAAGGGGCAGAGGGAGG - Intergenic
1080660096 11:34288843-34288865 ATGCAGGAACGTCCAGAGGAAGG - Intronic
1081644528 11:44780444-44780466 ATGAATGAATGAGCAGAGGAAGG - Intronic
1082007257 11:47426283-47426305 CTGGAGGAGCGGGCAGAAGATGG + Exonic
1083721373 11:64605251-64605273 ATGCAGAATCGGGCAGTGGAGGG + Intergenic
1086269546 11:85044966-85044988 ATGAATTAACGGGCAGAGAAAGG - Intronic
1086446098 11:86872464-86872486 GTGGAGGAATGGGCAGAGTACGG - Intronic
1086528501 11:87756839-87756861 AAGCAGGAGTGAGCAGAGGAAGG - Intergenic
1086911185 11:92474504-92474526 ATACAGGAAGGGGAAGGGGATGG + Intronic
1088117327 11:106327340-106327362 GTGCAGGAAGAGGCAGATGAGGG + Intergenic
1089073193 11:115716982-115717004 GTGCCGGCACGGGCTGAGGACGG - Intergenic
1090742915 11:129682341-129682363 AAGCAGGAAGAGGCAGGGGAAGG - Intergenic
1090788534 11:130070222-130070244 AAGCAGGGACGGGCGGGGGAGGG - Intronic
1090839106 11:130473883-130473905 CTGGAGTAGCGGGCAGAGGACGG + Exonic
1091216420 11:133905080-133905102 CTGCAGGAAGGGGCAGAGGGTGG - Intergenic
1091531652 12:1362700-1362722 GGGCTGGAAGGGGCAGAGGAGGG + Intronic
1091533816 12:1386798-1386820 CTGCAGGAATAGGCAGGGGATGG - Intronic
1092040802 12:5382520-5382542 CTGCAGGGACAGGCAGAGAAGGG - Intergenic
1092083982 12:5740698-5740720 TTGAAGGAGTGGGCAGAGGAAGG + Intronic
1093473831 12:19533496-19533518 ATGCAGGAACTCGAAGAAGAAGG + Intronic
1095477036 12:42596153-42596175 TTGGAGGAACCTGCAGAGGAGGG + Intergenic
1095978138 12:47953898-47953920 ATGCAGGAACGGGATGAGGCAGG - Intergenic
1096087463 12:48875277-48875299 ATCCAGGGATGGGCAGGGGAGGG - Intergenic
1096458512 12:51807355-51807377 AAACAGCAGCGGGCAGAGGAAGG + Exonic
1096787452 12:54025606-54025628 ATGCTGGAAGGGGGAGAGAAGGG - Intronic
1096817195 12:54208956-54208978 AGCCAGGAACTGGCAGAGGTGGG - Intergenic
1097186260 12:57198133-57198155 CTGCAGGAAGGGGCAGGGGAGGG - Intronic
1097226817 12:57481823-57481845 TTTAAGGAACAGGCAGAGGAAGG - Intronic
1097691884 12:62741364-62741386 ATGAAGCACGGGGCAGAGGAGGG - Intronic
1100499408 12:95159226-95159248 ATGCAGGCCCTGGCAGAGCAAGG - Intronic
1100738498 12:97564711-97564733 AGGAAGGAGAGGGCAGAGGAGGG - Intergenic
1101320453 12:103668885-103668907 ATGCAGGAAAGGACAGAGTCTGG - Intronic
1101899162 12:108778433-108778455 AGCCAGGAAGGGGCAGAGGCTGG - Intergenic
1101912034 12:108867205-108867227 ATGAAGGGATGGGTAGAGGAAGG - Intronic
1102107606 12:110338820-110338842 AGGCAGGTAATGGCAGAGGATGG - Intronic
1102477324 12:113196934-113196956 ATGCAGAAACGGGCTTGGGAAGG + Intronic
1103188475 12:118981186-118981208 ACCCAGGAAAGGGCTGAGGAAGG + Intergenic
1103293678 12:119867887-119867909 ATGGAGGAAGGGGCTGAGGAAGG - Intronic
1103547408 12:121712162-121712184 TTGCAGGACTTGGCAGAGGAGGG + Intergenic
1103884381 12:124189763-124189785 AAGCTGGAAGGGGCAAAGGAAGG - Intronic
1103899129 12:124294545-124294567 ATGCAGGAACAGCCAGATGCCGG + Intronic
1103949202 12:124542103-124542125 ATGCAGGAAGAGGCTGAGGCTGG - Intronic
1104017191 12:124969074-124969096 ATCCAGAAAGGGGCAGAGGGTGG - Intronic
1105580814 13:21693884-21693906 CAGCAGGGAGGGGCAGAGGATGG - Intronic
1105959430 13:25316801-25316823 ATGTGGGGAGGGGCAGAGGAGGG - Intronic
1111703765 13:91722605-91722627 AAGGAGGAAGAGGCAGAGGAAGG - Intronic
1111779679 13:92706597-92706619 ATACAGGAGCAGGCAGAGTAAGG - Intronic
1112382447 13:98905157-98905179 GTGCAAGAAGGGGAAGAGGAAGG + Intronic
1112570340 13:100588467-100588489 TTGCCAGAACGGGCAGAGGGCGG - Intronic
1113202844 13:107886390-107886412 AAGCAGGGTTGGGCAGAGGAAGG - Intergenic
1113711326 13:112467258-112467280 GTGCGGGAAGGGGAAGAGGAAGG - Intergenic
1113828339 13:113274240-113274262 ATGGAGGACCTGGCAGAGGGGGG - Intergenic
1115378325 14:32704051-32704073 ATTCAAGAAAGGTCAGAGGAGGG - Intronic
1115523864 14:34259796-34259818 ATACAGGCAAGGGGAGAGGAGGG - Intronic
1117816677 14:59606180-59606202 AGGCAGGAAAGGAGAGAGGAAGG - Intronic
1118049769 14:62014081-62014103 TTTAAGGAACGGGCAAAGGAAGG - Intronic
1118860073 14:69656109-69656131 ATGGAGGAAGAGGAAGAGGAAGG - Intronic
1119872939 14:78032522-78032544 ATGGAGGAAAGGGGAGAGGAAGG - Intergenic
1120030610 14:79636736-79636758 TTGCAGTGATGGGCAGAGGACGG - Intronic
1120542692 14:85769807-85769829 TTACAGGAGCAGGCAGAGGATGG + Intergenic
1120700124 14:87690420-87690442 AAGCAGGCAAGTGCAGAGGAAGG + Intergenic
1120858225 14:89231514-89231536 ATGGAGGGAAGGGCAGAGTAGGG + Intronic
1121635829 14:95453316-95453338 ATGGAGGATCGGTCAGAGGTCGG - Intronic
1121871134 14:97408354-97408376 ATGCAGGACCGTACAGAGGATGG + Intergenic
1121878438 14:97476838-97476860 ATCCAGGAACCAGCAGAAGATGG - Intergenic
1122499144 14:102184523-102184545 AAGCAGGAACAAGCAGAGGGCGG - Intronic
1124006487 15:25799039-25799061 AAGCAGGCATGGGAAGAGGAAGG - Intronic
1124494832 15:30180006-30180028 CTGCAGGAAGGGGCTGAGGTGGG + Intergenic
1124748737 15:32358639-32358661 CTGCAGGAAGGGGCTGAGGTGGG - Intergenic
1129044881 15:72725768-72725790 AAGGAGGAAGGGGAAGAGGAAGG - Intronic
1130983627 15:88830039-88830061 CTGCAGGATCTGGGAGAGGAGGG + Intronic
1131894588 15:97012620-97012642 ATGCAGAAAGGGGAAGCGGAAGG - Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133909127 16:10048959-10048981 ATGCATGAATGGGCAGGGGCTGG - Intronic
1133971430 16:10570966-10570988 TTGCAGGAACTGGCAGGGGCCGG + Intronic
1134042762 16:11080994-11081016 ATGCAGAAACTGGCAGCAGATGG + Intronic
1134848573 16:17461569-17461591 ATGGATGAATGGACAGAGGATGG + Intronic
1135198818 16:20419136-20419158 AGGCAGGAAGGGGCTGGGGAGGG - Intronic
1135219863 16:20604539-20604561 AGGCAGGAAGGGGCTGGGGAGGG + Intergenic
1135269228 16:21054532-21054554 ATCCTGGAAGGGGCAGAGGAGGG + Exonic
1136490322 16:30603874-30603896 ATGGAGGAAGAGGCAGAGTAGGG + Exonic
1136608575 16:31352806-31352828 AGGCTGGCATGGGCAGAGGAGGG - Intergenic
1137726082 16:50657659-50657681 CTGCAGGCAAGGGCAGAGGAGGG - Intergenic
1138345308 16:56316732-56316754 CTGCAGGCACGGGCAGGGCAGGG + Intronic
1138457370 16:57129133-57129155 CTGGAGGAACTGGCAGAGGTGGG + Intronic
1140134044 16:72189470-72189492 TTGGAGGAATGGGCAGAGAAAGG + Intergenic
1140311233 16:73850533-73850555 CTGCAGGATGGGGCAGAGAAAGG + Intergenic
1141198435 16:81878980-81879002 TTGCAAGACCTGGCAGAGGAGGG + Intronic
1141218657 16:82048392-82048414 TTTCAGGAAAGGGCACAGGAAGG + Intronic
1141220930 16:82068755-82068777 ATGAAGGAAAGAGAAGAGGAAGG - Intronic
1141631335 16:85289670-85289692 ATACAGGAGGGTGCAGAGGACGG + Intergenic
1141657522 16:85423995-85424017 ATGCAGGTGAGGGCTGAGGAGGG - Intergenic
1141725383 16:85784742-85784764 ATGCAGGAGCAGGCAGAGGTGGG - Intronic
1141885727 16:86890942-86890964 AGGCAGGAAGTGGCAGAGGCAGG + Intergenic
1141911005 16:87058208-87058230 TTGCAGGCACGGGGAGTGGAGGG - Intergenic
1141942492 16:87286903-87286925 AAGGAGGAAGGGGCAGGGGAGGG + Intronic
1141980192 16:87545321-87545343 CAGCAGGAAGGGGCAGGGGAGGG + Intergenic
1142753172 17:2000269-2000291 AAGCAGGATGGGGCAGAGGAAGG + Intronic
1143139575 17:4733737-4733759 ATGCAGGAGAGGGCTGAGGTGGG + Exonic
1143164292 17:4890160-4890182 AAGGAGGAAGAGGCAGAGGAGGG - Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143334671 17:6163267-6163289 CTGCAAAAATGGGCAGAGGAGGG - Intergenic
1143391414 17:6561231-6561253 AAGGAGGAAGGGGAAGAGGAAGG - Intergenic
1143486019 17:7254753-7254775 ATGCAGGACCTGGCAGAGTGTGG - Exonic
1143562704 17:7705146-7705168 AGGCGGGGAGGGGCAGAGGATGG - Intergenic
1144464107 17:15482727-15482749 ACGCAGGGAGGGGCAGAGGCTGG - Intronic
1144527554 17:16003108-16003130 CTGCAGGAAGGGGGAGAAGATGG + Intronic
1144678370 17:17176231-17176253 ATACAGAAACAGGAAGAGGAAGG - Intronic
1145274771 17:21422880-21422902 AAGCAGGAAGGAGCTGAGGAGGG + Intergenic
1145312622 17:21708779-21708801 AGGCAGGAAGGAGCTGAGGAAGG + Intergenic
1145993858 17:29094639-29094661 ATGCTGGAACAGGTACAGGAGGG - Exonic
1146590816 17:34126703-34126725 AGGCAGGCACAGGCAGGGGATGG + Intronic
1146947332 17:36882892-36882914 AGAGAGGAACGGGGAGAGGAGGG + Intergenic
1147181795 17:38691179-38691201 AGGCAGGACCTGGAAGAGGAAGG + Intergenic
1148193616 17:45697807-45697829 TTGAAGGAAGGGGAAGAGGAGGG - Intergenic
1148528558 17:48366466-48366488 GGGTAGGAAGGGGCAGAGGACGG + Intronic
1148820131 17:50355305-50355327 AGACAGCAAGGGGCAGAGGAAGG + Intronic
1149339889 17:55674397-55674419 AGGCAGGAAAGGGTAGTGGAGGG - Intergenic
1150560028 17:66286484-66286506 AAGGAGGAATGGGGAGAGGAGGG + Intergenic
1151248315 17:72813802-72813824 AGGCAGGATGGGGCAGAGGGAGG + Intronic
1151384335 17:73746001-73746023 CTGCATGAAAGGGAAGAGGAAGG - Intergenic
1151427702 17:74041755-74041777 ATGCAGGGACAGAGAGAGGAAGG - Intergenic
1152219018 17:79050745-79050767 CCCCAGGAGCGGGCAGAGGAAGG - Intergenic
1152221762 17:79072636-79072658 ATGAAGGAGGAGGCAGAGGAAGG + Intergenic
1152451469 17:80383903-80383925 CTGCAGGAAATGCCAGAGGATGG - Exonic
1152696541 17:81800511-81800533 ATGCAGGAAGGGAAACAGGAGGG - Intergenic
1152798451 17:82320207-82320229 ATGGAGCAAAGGCCAGAGGAGGG - Intergenic
1154929348 18:20976021-20976043 TTTAAGGAATGGGCAGAGGAAGG - Intronic
1156597746 18:38566702-38566724 ATGGAGGAAGGGAGAGAGGAAGG + Intergenic
1156740539 18:40322076-40322098 ATGGTGGAAGGGGAAGAGGAAGG - Intergenic
1158358622 18:56647953-56647975 AAGCAGGATTGGGCCGAGGAAGG + Intronic
1158571245 18:58598472-58598494 AGGCAGGACCTGGCAGAGGCAGG + Intronic
1160600435 18:80008567-80008589 AGACAGGAAGGGGGAGAGGAAGG - Intronic
1160967308 19:1752414-1752436 AAGCAGGAAGGGGCTGAGGCTGG + Exonic
1161528281 19:4770875-4770897 ATACAGGCACAGGCAAAGGAGGG + Intergenic
1161870325 19:6864770-6864792 CAGCAGGAAGGGGCAGAGGAAGG + Intergenic
1163095857 19:15056479-15056501 ATGCAGGAGCCAGCAGAGGTTGG - Exonic
1163238472 19:16043560-16043582 AGGGATGAATGGGCAGAGGATGG + Intergenic
1164412925 19:28020715-28020737 AAGCAGGAGCGGGAGGAGGAGGG + Intergenic
1164843153 19:31409730-31409752 AAGCAGGACATGGCAGAGGAAGG - Intergenic
1164881440 19:31735613-31735635 AGGGAGGAAGGGGGAGAGGAAGG - Intergenic
1164884692 19:31768408-31768430 ATGTGGGAAGGGGGAGAGGAGGG + Intergenic
1166049217 19:40248135-40248157 CTGCAGGAAGGGGCAGAGCTGGG - Intronic
1166158869 19:40936591-40936613 ATGCAGGCACGGGAATAGAAAGG + Intergenic
1166226886 19:41401530-41401552 ATGAAGGAGTGGGCAGAGCAGGG - Intronic
1167525101 19:49978741-49978763 ATGCAAGAAGGGACAGAAGATGG + Intronic
1168264200 19:55212742-55212764 AAGCAGTATGGGGCAGAGGAAGG + Intergenic
1168520321 19:57044985-57045007 AGGCAGGAAAGAGCTGAGGAAGG + Intergenic
925299438 2:2800161-2800183 ATGGAGGAAGGGAAAGAGGAAGG + Intergenic
925426102 2:3750037-3750059 AGCCGGGAACAGGCAGAGGAAGG - Intronic
926190246 2:10722431-10722453 ATGCAGGATGGGGTGGAGGAAGG - Intronic
929608061 2:43248893-43248915 AAGCAGGAAGCAGCAGAGGAGGG - Intronic
930277598 2:49331775-49331797 ATGAAGGAAGGGGCAAGGGAGGG + Intergenic
930347893 2:50208426-50208448 TTGCAAGAATGGTCAGAGGAGGG - Intronic
931086064 2:58831765-58831787 ATGCAGCCACTGCCAGAGGATGG + Intergenic
932570800 2:72937386-72937408 CTGCAGGCAAGGGGAGAGGAGGG + Intergenic
933248246 2:79999648-79999670 ATGGATGAATGGACAGAGGAAGG - Intronic
933533381 2:83538876-83538898 AAGAAGGAAGGGGCAGAGGGAGG + Intergenic
933813346 2:86047148-86047170 ATGCAGGTATGTGCAGAGGCGGG - Exonic
934038831 2:88110855-88110877 ATGGAGGAGGGTGCAGAGGAGGG + Exonic
934074344 2:88415095-88415117 ATGCAAAAACAGGCAGTGGATGG + Intergenic
934602148 2:95665840-95665862 GTACAGAAACAGGCAGAGGAGGG - Intergenic
934857411 2:97737896-97737918 AGGCAGGCGCGGGCAGAGGCAGG + Exonic
935275357 2:101471676-101471698 CTGCAGAAACGGGGAGAGGTGGG - Intronic
936535505 2:113307995-113308017 GTTCAGAAACAGGCAGAGGAGGG - Intergenic
936945812 2:117929786-117929808 GTGCAGGAATGGGGAGCGGAGGG - Intronic
937088689 2:119190219-119190241 AAGCAGGGATGGGCAGAGGCAGG + Intergenic
937286807 2:120758976-120758998 ATGCAGGATTGGGCACAGAAAGG - Intronic
937980172 2:127610026-127610048 GGGCAGCAGCGGGCAGAGGAGGG + Intronic
938569719 2:132551541-132551563 ATGCAAGGATGGGCAGTGGAAGG + Intronic
939016655 2:136912001-136912023 ATGCAGGAAGGGAAAGAGGGAGG + Intronic
939707048 2:145468067-145468089 CTGCAGGAGCGACCAGAGGATGG - Intergenic
942215826 2:173718292-173718314 ATCAAGGAAGGGGCAGAGGGAGG - Intergenic
942250832 2:174046574-174046596 AGCCAGGAAGGGGCAGAGCAAGG - Intergenic
942312979 2:174672730-174672752 CTGCAGGAACAGGGAGAAGATGG - Intronic
942624179 2:177881650-177881672 AAGCAGGAGTGGGCAAAGGATGG + Intronic
942971041 2:181958216-181958238 CTGCAGGATCGGGCTGAGAAAGG - Intronic
944666137 2:201961240-201961262 ATGGGGGAACAGGCAGAGGCGGG + Intergenic
945474460 2:210264779-210264801 AAGCAGGAAAGGTCAGAGAATGG - Intergenic
945935338 2:215898011-215898033 TTTCAGGAAGGGGCAGAGGAAGG - Intergenic
946117466 2:217475921-217475943 ATGCAGAACAGGGCAGAGCAAGG - Intronic
946211405 2:218150196-218150218 ATGCAGGAAAGGGTGGAGGAAGG - Intergenic
947534602 2:230933062-230933084 AGGCAGGAAGGGGCAGGGAAAGG - Intronic
947636787 2:231684335-231684357 ATGCACAAACGGACAGAGCAGGG - Intergenic
947849173 2:233271217-233271239 ATACAGGAAGGGGCCGAGGTAGG + Intronic
947948844 2:234130219-234130241 AAGCAGGAAAGGGGAGAGAAAGG - Intergenic
947982990 2:234425937-234425959 ATGCGGGAAGAAGCAGAGGATGG + Intergenic
948547177 2:238741163-238741185 CAGCAGTAAAGGGCAGAGGAGGG + Intergenic
948605348 2:239131438-239131460 CTGCAGGAAAGGGCAGAACATGG + Intronic
948691465 2:239707313-239707335 AGGCAGGGAAGGGCAGAGCAGGG - Intergenic
948691544 2:239707543-239707565 AGGCAGGGAAGGGCAGAGCAGGG - Intergenic
948696378 2:239735033-239735055 ATGCAGGAGCATGCAGAGGCTGG + Intergenic
1169704619 20:8488367-8488389 ATGTAGGATGGGGCAGAGGAAGG - Intronic
1170427281 20:16247431-16247453 AAGCTGGATTGGGCAGAGGAAGG + Intergenic
1170586890 20:17741525-17741547 ATGCAGGCCCTGGCAGTGGAAGG + Intergenic
1170773202 20:19352041-19352063 AAGCAGGACAGGGCAGGGGAGGG + Intronic
1170879956 20:20288225-20288247 ACACAGGAAGGGGAAGAGGATGG + Intronic
1170903502 20:20489019-20489041 ATGCATGAAAGGCCAGGGGAAGG + Intronic
1170914187 20:20606488-20606510 ATGCAGGAGCGAGCAGGTGAAGG - Intronic
1171065114 20:22007651-22007673 ATGCAGGTCCTGGCAGAGGCTGG + Intergenic
1171400637 20:24871225-24871247 ATGCAGGGACAGGCTGAGCATGG + Intergenic
1171437559 20:25135085-25135107 ATGCAGGCAGGGGCAGGGGTGGG - Intergenic
1172511377 20:35503485-35503507 ATGCAGGAACGGGCAGAGGAAGG + Exonic
1174427061 20:50439308-50439330 CTGCAGGCCTGGGCAGAGGAAGG - Intergenic
1174753633 20:53137037-53137059 ACACAGGGACAGGCAGAGGAGGG - Intronic
1175189101 20:57199220-57199242 GTGCAGGATCTGGCAGGGGAGGG + Intronic
1175738532 20:61404253-61404275 AATCAGGAACAAGCAGAGGAAGG - Intronic
1176076971 20:63253140-63253162 AAGCAGGAATGGGGAGAGCAAGG - Intronic
1176246261 20:64098633-64098655 ATCCAGGAAGGCGTAGAGGATGG - Exonic
1178330697 21:31688330-31688352 GTGCAGGAACAGGAATAGGAGGG + Exonic
1179187418 21:39095724-39095746 ATGCAGTAACAGGCAGAGTGAGG + Intergenic
1179637317 21:42721466-42721488 AGGCAGGACAGGCCAGAGGAAGG + Intronic
1179950706 21:44707389-44707411 GCGCAGGGAGGGGCAGAGGAGGG + Intronic
1180054459 21:45350168-45350190 ATGTAGGAATGAGCAGAGGCAGG - Intergenic
1180622758 22:17172585-17172607 AGGCAGGGAAGGACAGAGGAGGG + Intergenic
1180742809 22:18065482-18065504 ATGCAGGTGCAGGCAGAGGCGGG + Intergenic
1181455631 22:23058771-23058793 ATGAAGGCACAGGCAGAAGAGGG + Intergenic
1181584309 22:23844783-23844805 AAGCAGAATGGGGCAGAGGATGG + Intergenic
1182302834 22:29347467-29347489 AGCCAGGAAGGGGCAGAGGAGGG + Intronic
1183331832 22:37226387-37226409 CTGCAGGAATGGGCAGAGTGGGG + Intronic
1183632348 22:39041006-39041028 AGGCAGGAAGGGGCAGCAGAGGG - Intronic
1184835414 22:47018137-47018159 AAGCAGGAACGGCCAGAGTCAGG - Intronic
949184052 3:1169056-1169078 ATGCAGTGAGTGGCAGAGGAAGG + Intronic
951031436 3:17886093-17886115 AGGCAGGATTGGGCAGAGGAAGG + Intronic
951551309 3:23877977-23877999 ATGAAGGAAGGGGCAGAGGCAGG - Intronic
952722224 3:36545355-36545377 ATGCAGGATGGGGCAGGGGAAGG - Intronic
953766326 3:45746545-45746567 ATGGAGGACCAGGCAGAGAAGGG + Intergenic
953813453 3:46133724-46133746 ATGAAAGAAAGGGCAGTGGAGGG - Intergenic
953931306 3:47007214-47007236 AGGCAGGAGGGGGCAGAGGTGGG - Intronic
954372204 3:50174800-50174822 AGGCAGGAAGGGGCAGAGCTGGG - Intronic
954385603 3:50242282-50242304 AGGCAGGACCGGGCAGATGGGGG + Intronic
959443613 3:106410207-106410229 ATGCTGGAAAGGGTAGTGGAGGG - Intergenic
960882482 3:122359178-122359200 ATTCAGGAAAGGGAAGAGCAGGG - Intergenic
960950643 3:122996511-122996533 ATCCAGGCACGAGCAGTGGAAGG + Intronic
962209758 3:133467444-133467466 AAGCAGGACAGGGCAGAGGAAGG - Intronic
963855741 3:150251422-150251444 CTGCAGGAACCAGCAGAGAAGGG + Intergenic
964638094 3:158879549-158879571 AGGCAGGAAGGGGAAGAGGCAGG - Intergenic
965680696 3:171248235-171248257 ATGAAGGCAGGGGCAGCGGAAGG + Intronic
965800603 3:172489795-172489817 ATGGAGGAATGGGGAGATGATGG + Intergenic
966507656 3:180725073-180725095 ATGGTGGAAGGGGAAGAGGAAGG - Intronic
966915696 3:184583160-184583182 ACGCAGGAACAGGCGGGGGAGGG + Intronic
967727972 3:192879620-192879642 AAGCAGGGAGGGGCAGAGAAGGG + Intronic
968472278 4:787632-787654 ACGCAGGAAGGGGCAGGGAAGGG + Intronic
968533981 4:1112727-1112749 AGGCAGGAAGGGGCCGTGGAGGG - Intronic
968642856 4:1722971-1722993 AGGCAGGACCGGGCAGTAGAGGG - Intronic
969246648 4:5938906-5938928 AAGCATGAGCAGGCAGAGGAAGG - Intronic
969513473 4:7632860-7632882 ATGCTGGAGGGGGCAGAGGAAGG + Intronic
969531669 4:7734012-7734034 AGGCAGGGACAGGCAGGGGACGG + Intronic
969573952 4:8025623-8025645 ACTCAGGACGGGGCAGAGGAGGG + Intronic
969712076 4:8850247-8850269 AGGCGGGCACGGGCAGAGGTCGG - Intronic
969916909 4:10500216-10500238 ATGAAGGAAGGGGTAAAGGAAGG - Intronic
969936516 4:10687514-10687536 AAGCAGGAAAGGGAAGAGGAGGG + Intergenic
970001194 4:11367763-11367785 GAGCAGGAAGGGGAAGAGGAGGG - Intergenic
970495486 4:16620691-16620713 ATTCAAGAACAGGAAGAGGAAGG - Intronic
973993658 4:56435881-56435903 ATGCAGGGAAGGGCATATGAAGG - Intronic
975221640 4:71819164-71819186 ATGAATGAAGGGACAGAGGAAGG + Intergenic
975723486 4:77270279-77270301 AAGCAGGACCAGGGAGAGGAAGG + Intronic
975725863 4:77291119-77291141 AAGCAGGACCGGGCAGAGGGAGG + Intronic
975728124 4:77312199-77312221 TTGCAGGAACATGCAGGGGAAGG + Intronic
975746371 4:77479449-77479471 TTGCAGGAAAATGCAGAGGAGGG + Intergenic
977613200 4:99058135-99058157 ATGTAGGAGAGGGAAGAGGAGGG + Intronic
979541802 4:121892075-121892097 AAGCAGGAGCTGGGAGAGGAAGG + Intronic
981914406 4:150017868-150017890 TGGCAGGAATGGTCAGAGGAAGG + Intergenic
982976962 4:162075937-162075959 AAGCAGGAGTGTGCAGAGGAAGG - Intronic
984539883 4:181024348-181024370 ATGCAGCAAAGGACAGATGAAGG - Intergenic
984894705 4:184527658-184527680 AAGCAGGACTGGGCAGAGAAAGG - Intergenic
985348779 4:189035700-189035722 ATTCTGGAACGCGGAGAGGAAGG - Intergenic
985614382 5:910777-910799 CTGCAGGAAGGGCCAGAGGGAGG - Intronic
985928456 5:3035905-3035927 ATGAGGGACCGGGCAGAGGAGGG - Intergenic
986067074 5:4245210-4245232 ATGGAGGAAAGGACAGATGAAGG - Intergenic
986072900 5:4304578-4304600 ATGGATGAACGGGTAGATGATGG - Intergenic
987230698 5:15890665-15890687 ATGCAGGGAGGGGCAGAGGATGG - Intronic
987427234 5:17787169-17787191 ATGAAGGAAGGGGAAGGGGAAGG - Intergenic
990198114 5:53341924-53341946 AAGCAGGATTGGGAAGAGGAAGG - Intergenic
990289225 5:54331618-54331640 ATGCTGGAAAGGGCAAATGACGG - Intergenic
991666096 5:69001389-69001411 ATGCAGTAGCTGGCAGATGAAGG + Intergenic
992492519 5:77259152-77259174 AAGCAGGAACCAGGAGAGGAGGG - Intronic
993183175 5:84581780-84581802 AAGCAGGAAAAGGGAGAGGAAGG - Intergenic
994813841 5:104557785-104557807 ATGTTGGAACAGGCAGAGGTTGG - Intergenic
994895282 5:105695278-105695300 AAGCAGTGACGGGAAGAGGAGGG + Intergenic
995842088 5:116452169-116452191 ATGCAGGGGTTGGCAGAGGAAGG - Intronic
996570444 5:124928053-124928075 AAGCAGGAATGGGCAGGGAAAGG + Intergenic
997445198 5:133935286-133935308 ATGCAGGGAGGGGCAGAGCATGG - Intergenic
997745755 5:136298766-136298788 AAGCAGGATGGGGCAGAAGAAGG - Intronic
997841736 5:137247189-137247211 AGTGAGGAAAGGGCAGAGGAGGG + Intronic
998182617 5:139956027-139956049 ATGCTGAGACAGGCAGAGGAAGG + Intronic
998587859 5:143447136-143447158 ATGCATGAAGGATCAGAGGATGG - Intergenic
998921631 5:147074387-147074409 ATTCAGGAGCGGGAAGAGCAAGG + Intronic
999319218 5:150603061-150603083 ATGTGGGAAGGGGCAGGGGATGG + Intronic
999417843 5:151415390-151415412 CTGCAGGAACTGGCAGAGCAAGG - Intergenic
999563150 5:152827074-152827096 ATACAGAAACGCCCAGAGGAAGG - Intergenic
1000247789 5:159463254-159463276 ATGCAGGAAGGGACTGAGCAGGG - Intergenic
1000441702 5:161271483-161271505 ATGAAGGAAAGAGTAGAGGAAGG + Intergenic
1001856381 5:175014147-175014169 ATGCAGGGTGGGGCAGAGGATGG + Intergenic
1001917181 5:175571590-175571612 ATGCAGGAGCAGGGAGAGGAAGG - Intergenic
1002080128 5:176732800-176732822 AAGCGGGGACGGGGAGAGGAGGG + Intergenic
1002768732 6:268508-268530 ATGCATGAGCTGGCAGAGGCGGG - Intergenic
1003079871 6:3013416-3013438 GGGCAGGAACGGGAAGAGAAGGG - Intronic
1003303914 6:4909359-4909381 ATGCAGGAAAGGGGAGGGCATGG - Intronic
1003329372 6:5117034-5117056 AGGCAGGAAGTGGCAGAGGCAGG - Intronic
1003533812 6:6958741-6958763 ATGCAGGGATGGGAAGAGGCCGG - Intergenic
1003754345 6:9099935-9099957 ATGCTGGAATGGGAAGAGAAGGG + Intergenic
1004237934 6:13891325-13891347 AAGCAGGAAAGGGCAGATGCTGG - Intergenic
1005307849 6:24530908-24530930 ATGCAGGAGTGGGCAGGGCAAGG - Intronic
1005490249 6:26341456-26341478 AAGCGGGAAGGGGCAGAGGATGG + Intergenic
1005629733 6:27696188-27696210 ATGCAGGAAATGGCAGAAAACGG - Intergenic
1005952880 6:30644412-30644434 ATGGAGGAAAGGAGAGAGGAAGG - Intronic
1007473868 6:42106711-42106733 GTGCAGGAGGGGGCAGGGGAGGG + Exonic
1007502051 6:42305757-42305779 ATGCAGGAAAATGGAGAGGAGGG + Intronic
1007509846 6:42366515-42366537 ATGCAGGTGCAGGAAGAGGAGGG - Intronic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1009850609 6:69193231-69193253 AGGCAGGAGCTGGCAGAAGATGG - Intronic
1010029698 6:71260102-71260124 AAGCAGGATAGGGCAGGGGAAGG - Intergenic
1011125350 6:84001481-84001503 AATCAGGAATGGGCAGAGGGGGG - Intergenic
1011287841 6:85744027-85744049 ATTGAGTAACGGGCAGAGGTTGG + Intergenic
1015554340 6:134445369-134445391 AGGCAGGAATGAGCCGAGGAAGG + Intergenic
1016731352 6:147431672-147431694 CTGCAGGAAGCGGAAGAGGAAGG - Intergenic
1016775509 6:147900211-147900233 ATGGAGGATCGGTCAAAGGAGGG + Intergenic
1017031318 6:150225319-150225341 ATCCAGTCACGGGCAGAGGTAGG - Intronic
1017667317 6:156733094-156733116 ATGTGGGAACAGGCAGAGAAAGG - Intergenic
1018062740 6:160103363-160103385 ATGCAGAATGGGGCAGAAGAAGG + Intronic
1018174127 6:161164349-161164371 TTGCAGGAGCTGGCAGAGCAGGG - Intronic
1018883142 6:167905008-167905030 AGGCAGGCACGGGCACAGGATGG - Intronic
1018885119 6:167928685-167928707 ATGCACAAATGGGCAGAGGCCGG - Intronic
1019483324 7:1276212-1276234 GCGCGGGAGCGGGCAGAGGAAGG - Intergenic
1019646597 7:2132988-2133010 ACGCAGGAAGGGGGAGAGCAGGG - Intronic
1020165407 7:5803822-5803844 ATGCATGAAGAGGCAGAGCACGG - Intergenic
1020279324 7:6642449-6642471 CAGCTGGAGCGGGCAGAGGACGG + Exonic
1020290824 7:6721106-6721128 ATGGAAGAACGGGGAGGGGAAGG - Intergenic
1021705687 7:23365227-23365249 ATGGAGGCAGGGGTAGAGGAGGG + Intronic
1021918108 7:25455698-25455720 ATGCAGAAGGGGGCAGAGGTGGG - Intergenic
1022138187 7:27468739-27468761 AAGCAGGATCGGGCAGTGGGAGG - Intergenic
1022176119 7:27873539-27873561 GTGCAGGAAAGGGTAGAGGGTGG - Intronic
1022822360 7:33974044-33974066 AGGCAAGAAGGGGCAGAGGCAGG - Intronic
1023974145 7:45015445-45015467 ATCCAGGAAGGGGAAGGGGAAGG - Intronic
1024350688 7:48359640-48359662 AAGCAGGGAAGGGCAGAGGCCGG + Intronic
1024548949 7:50544437-50544459 AGGCAGGTAAGGGCAGAGGCAGG - Intronic
1025025983 7:55516554-55516576 ATGCAGGGACAGGCAGAGTAGGG + Intronic
1026980486 7:74523874-74523896 GGGCAGGAACGGGCAGACGGGGG + Intronic
1028198630 7:87934999-87935021 AGGCAGGAACCGGGAAAGGAGGG - Intronic
1028887719 7:95952793-95952815 ATGCATAAAAGGACAGAGGAAGG - Intronic
1029403734 7:100360661-100360683 ATGGAGGAATGGCCAGAGGTGGG + Intronic
1029690100 7:102175571-102175593 ATGCAGGCAGGTGCAGAGGCTGG - Intronic
1030864610 7:114684326-114684348 ATTCAGAAACTGTCAGAGGAGGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031929859 7:127674085-127674107 AGGCAGGAAGGGAGAGAGGAAGG - Intronic
1032197509 7:129797858-129797880 ATGCAGGAACCTGCAGCCGACGG - Intergenic
1033346887 7:140532641-140532663 ATGTAGGATGGGGCAGAGTAGGG + Intronic
1034447996 7:151123139-151123161 ATGCAGGAAGGAGCAGAGGAGGG - Intronic
1035291828 7:157844218-157844240 CTGCAGGAAAGGGAACAGGAGGG + Intronic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1036263504 8:7257903-7257925 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036264807 8:7265525-7265547 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036266106 8:7273147-7273169 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036267409 8:7280769-7280791 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036268711 8:7288391-7288413 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036270013 8:7296013-7296035 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036297881 8:7551042-7551064 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036299185 8:7558690-7558712 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036300490 8:7566340-7566362 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036301793 8:7573984-7574006 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036303090 8:7581633-7581655 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036315546 8:7716442-7716464 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036316854 8:7724090-7724112 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036318161 8:7731738-7731760 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036319470 8:7739386-7739408 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036320777 8:7747033-7747055 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036322087 8:7754681-7754703 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036323396 8:7762329-7762351 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036324692 8:7769976-7769998 ATTCAGGGACGGGGAGAGGCGGG + Intergenic
1036351342 8:8014331-8014353 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036352647 8:8021977-8021999 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036353939 8:8029625-8029647 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036417735 8:8566050-8566072 TTGCTGGAACGTTCAGAGGACGG + Intergenic
1036846605 8:12174750-12174772 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1036867967 8:12417069-12417091 ATTCAGGGACGGGGAGAGGCGGG - Intergenic
1037009749 8:13826232-13826254 ATGGAGGAAAGGGCAGAAAATGG + Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039742466 8:40395155-40395177 TTGCATGAACCAGCAGAGGAGGG + Intergenic
1040394720 8:46986399-46986421 AGGCAGGAAGAGGCAGAGGCAGG + Intergenic
1040502126 8:48014352-48014374 ATGCAGGAAAGGGCCGGGCATGG + Intronic
1041780167 8:61569103-61569125 ATACAGGCACAGGTAGAGGATGG + Intronic
1042206095 8:66331283-66331305 ATGCAGGAAGGGGCTAAGCAAGG - Intergenic
1044744547 8:95359299-95359321 GTGTAGGAAAGGGCAGAGGTAGG + Intergenic
1045029776 8:98124074-98124096 ATGCAGAAATGGGCAGAGGATGG + Intronic
1045126218 8:99091943-99091965 ATGCAGGAAAGAGCTGAAGAAGG - Intronic
1045479946 8:102583760-102583782 ATGCAGCAAGGGGTTGAGGAAGG - Intergenic
1045922158 8:107544298-107544320 AGGGAGGAAAGGGGAGAGGAGGG + Intergenic
1046598446 8:116288798-116288820 ATGCAGAACTGGGCTGAGGACGG + Intergenic
1048042617 8:130745894-130745916 AGGCAGGAAGAGGAAGAGGAAGG + Intergenic
1049932629 9:471261-471283 GTGCAGGAAGGGACCGAGGAGGG + Intronic
1052236499 9:26217459-26217481 ATGCAGAAGCAGGCACAGGAAGG + Intergenic
1052342151 9:27374545-27374567 AGGCAGGAGTGGGAAGAGGAGGG + Intronic
1053446512 9:38157246-38157268 ATGCAGGAAAGAGATGAGGATGG - Intergenic
1055085441 9:72308893-72308915 ATGAAGGAAGGAGCAAAGGAAGG + Intergenic
1056530664 9:87484388-87484410 AGGCATGAACGGGTAGAGCATGG + Intergenic
1057210178 9:93196882-93196904 CTGCAGGCCCAGGCAGAGGAGGG - Intronic
1057495234 9:95555243-95555265 ACCCAGACACGGGCAGAGGAGGG + Intergenic
1057501820 9:95602377-95602399 TTGCAGGATTGGGCAGGGGAAGG + Intergenic
1057980884 9:99662008-99662030 ATGGAGGAAGGGGAAAAGGAAGG + Intergenic
1058420461 9:104828412-104828434 ATGCAGGATTGGGCAGAGGGAGG - Intronic
1058806094 9:108593632-108593654 ATGGAGGAAGGTGAAGAGGAAGG + Intergenic
1058856637 9:109068866-109068888 TTGAAGGAAAGGGTAGAGGATGG + Intronic
1058980643 9:110166830-110166852 ATGCAGTTACAGGCAGAGGTGGG - Intronic
1060115957 9:120940912-120940934 ATGCAGACACTGGGAGAGGACGG - Intergenic
1060961346 9:127682966-127682988 AGGCAGGAATGGGCAGTGAATGG + Intronic
1061081041 9:128370516-128370538 ATGCTGGAACATGGAGAGGAAGG - Intergenic
1061490153 9:130939945-130939967 ACGCAGAAAGGGGCGGAGGAGGG - Intergenic
1061534497 9:131239201-131239223 GAGCAGGAAGGGACAGAGGATGG - Intergenic
1062169088 9:135124550-135124572 AGGAAGGAAGGGGCAGGGGAAGG + Intergenic
1203793992 EBV:166437-166459 ACGAAGAAGCGGGCAGAGGAAGG + Intergenic
1187379341 X:18786353-18786375 ACCCAGGAAGGGGCAGAGGCAGG - Intronic
1188730705 X:33642423-33642445 ATGCTGGAAAGGGTAGTGGAAGG + Intergenic
1189219809 X:39361861-39361883 ATGCAGGACAGGGCAGGGCAGGG + Intergenic
1189278606 X:39805156-39805178 AGGCAGGAGCAGGCAGAGGCAGG + Intergenic
1189716413 X:43871040-43871062 AAGCAGGATTGGGCAAAGGAAGG + Intronic
1190711620 X:53075713-53075735 AGGCAGGAACGGTGAGAGCAAGG - Intronic
1190712661 X:53081546-53081568 ATGCGGGAAGGGGCAGAAGGGGG + Intergenic
1192168856 X:68842279-68842301 GGGCAGGTACGGGCAGATGATGG + Intergenic
1192190893 X:68990502-68990524 GTCCAGGAAGGGGCAGTGGAAGG + Intergenic
1192317812 X:70066153-70066175 AGGGAGGCACTGGCAGAGGAAGG + Intergenic
1194898655 X:99478062-99478084 AAGCAGGAATGGGAAGAGGTTGG - Intergenic
1195379539 X:104257264-104257286 ATGGAGGAAGGGGCCCAGGAAGG - Intergenic
1198323687 X:135545073-135545095 ATGGAGTAAGGGGCAGAGGAAGG - Intronic
1199599189 X:149531504-149531526 AGGCAGGAATGGTTAGAGGAGGG + Intronic
1200165293 X:154031264-154031286 CTCCAGGAACTGGCAGAGGCCGG - Exonic
1200412846 Y:2878294-2878316 ATGCAGGGAGGGGGAGACGAGGG - Intronic
1202099126 Y:21287345-21287367 ATTCAGTAACAGGCAGAGGCTGG + Intergenic