ID: 1172512756

View in Genome Browser
Species Human (GRCh38)
Location 20:35511985-35512007
Sequence CTGTCTCCACTTGTGCAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 179}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172512752_1172512756 21 Left 1172512752 20:35511941-35511963 CCTTCAACAATAAACCCTGGGAT 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1172512756 20:35511985-35512007 CTGTCTCCACTTGTGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 179
1172512754_1172512756 6 Left 1172512754 20:35511956-35511978 CCTGGGATCTTTGCATTCATTTT 0: 1
1: 0
2: 3
3: 37
4: 350
Right 1172512756 20:35511985-35512007 CTGTCTCCACTTGTGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 179
1172512753_1172512756 7 Left 1172512753 20:35511955-35511977 CCCTGGGATCTTTGCATTCATTT 0: 1
1: 1
2: 3
3: 83
4: 933
Right 1172512756 20:35511985-35512007 CTGTCTCCACTTGTGCAGCTGGG 0: 1
1: 0
2: 1
3: 14
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172512756 Original CRISPR CTGTCTCCACTTGTGCAGCT GGG Exonic
903267766 1:22168379-22168401 CTGTCTCCACTTCTGATGCCAGG + Intergenic
903360689 1:22775227-22775249 CTGTGTGCACTTATGCAGGTTGG + Intronic
904429460 1:30452666-30452688 CTGTCTACACTTGTGCCCTTGGG + Intergenic
908751261 1:67425994-67426016 CAGTCTCCTCTTGAGTAGCTCGG - Intronic
910147441 1:84098714-84098736 GTGCCTGCACTTGTGCAGCTGGG - Intronic
913060702 1:115204105-115204127 CACTCTACACATGTGCAGCTTGG - Intergenic
913170090 1:116224072-116224094 CTGGCACCAGTTTTGCAGCTTGG - Intergenic
914222189 1:145691173-145691195 CTTTCCCCATTGGTGCAGCTGGG - Intronic
915100095 1:153492990-153493012 CTTTTTCCACTGATGCAGCTTGG + Intergenic
917460183 1:175222687-175222709 CTCCCTCCACATGTGCAGTTAGG - Intergenic
922208729 1:223470890-223470912 CTGACAGCACTTGTGAAGCTGGG - Intergenic
923621432 1:235582554-235582576 CTGTCTGCACTTCTGGAGCACGG + Intronic
924886708 1:248226082-248226104 CTGACTCAACTTTTGGAGCTCGG + Intergenic
1063539126 10:6914349-6914371 CTGTGTCCACTGGAGGAGCTCGG - Intergenic
1064106256 10:12503239-12503261 GTGTGTGCACTTGTGCCGCTGGG + Intronic
1068007235 10:51406077-51406099 CTGTCTCTACTTCTCCAGTTAGG + Intronic
1070333506 10:75434451-75434473 CTGTTTCCTCTTCTGCAACTGGG - Intronic
1070737838 10:78876541-78876563 CTGTCTTCACTTGCTCTGCTGGG + Intergenic
1071840338 10:89464079-89464101 CTTTCTCCAGGTGTGCAGCATGG - Intronic
1072360105 10:94651298-94651320 CAGTATCCACTTCTGAAGCTGGG - Intergenic
1073959061 10:108904994-108905016 CTGCATCCTCTTATGCAGCTGGG - Intergenic
1074418182 10:113285526-113285548 CCTGCTCCACATGTGCAGCTTGG + Intergenic
1075960208 10:126562069-126562091 CTGTCGCCACTTGGGCAGAGGGG - Intronic
1079250984 11:18787795-18787817 CTGTCTCCCCTGGTAGAGCTTGG + Intronic
1085394849 11:76202056-76202078 CTCTCTGCAGTTCTGCAGCTCGG + Intronic
1088477854 11:110262467-110262489 CAGTCTCCTCCTGAGCAGCTGGG - Intronic
1089364241 11:117911336-117911358 CTCTCTCCACCAGTGCAGTTAGG - Intronic
1089364452 11:117912650-117912672 CTCTCTCCACCAGTGCAGTTAGG + Intronic
1091753304 12:3036016-3036038 CTGTCTCCATCTGTGATGCTGGG - Intronic
1093546219 12:20352256-20352278 CTGTCTCTATTTGAGCAGCCCGG - Intergenic
1096195556 12:49646980-49647002 CTGTTGCCACTTGTTCCGCTGGG + Exonic
1096646934 12:53043909-53043931 CTGGGTCCACTCCTGCAGCTGGG - Intergenic
1101558355 12:105831856-105831878 CTGTCCCCTGTTGTGCATCTGGG - Intergenic
1103923893 12:124413265-124413287 CTGTGTCCACCTCTGCAGCGTGG + Intronic
1104069308 12:125330786-125330808 CTGCCTCCCCAAGTGCAGCTTGG - Intronic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1106477139 13:30108512-30108534 CTGGGTCCATTTTTGCAGCTGGG + Intergenic
1113066883 13:106381766-106381788 CTGTCCCCCCTTTTGCAGATGGG + Intergenic
1113392352 13:109909652-109909674 CTGTCGACATTGGTGCAGCTGGG - Intergenic
1113576718 13:111400106-111400128 CTGTCCCCACTTTAGCAGCCAGG - Intergenic
1114375425 14:22141185-22141207 CTGTCCCCAGTGGTGCTGCTGGG + Intergenic
1114381383 14:22208156-22208178 CTGTCTCCAAACCTGCAGCTGGG + Intergenic
1114447644 14:22801660-22801682 CTGTCTCCTCCTGAGTAGCTGGG - Intronic
1115499390 14:34035875-34035897 CTGTCTGTACATGTCCAGCTTGG - Intronic
1117006279 14:51424303-51424325 CTGTATCCACTTGTGAACTTGGG - Intergenic
1121220808 14:92284074-92284096 CTAACCCCACTTGTGGAGCTGGG - Intergenic
1121699861 14:95944410-95944432 CTCTTTCCTCTGGTGCAGCTGGG + Intergenic
1122982626 14:105198490-105198512 CTGTCCCCACCTGTGCCCCTGGG - Intergenic
1123011578 14:105352419-105352441 CTGTCTCCACTTGTCCACTGGGG - Exonic
1124472850 15:30003546-30003568 CCATCTCCACTGGTGTAGCTCGG - Intergenic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1131058279 15:89389439-89389461 CTGTCTCCTCTTCTGCAGTTGGG + Intergenic
1132625840 16:891113-891135 CTGTGTCCACGTGGCCAGCTGGG - Intronic
1133732109 16:8586851-8586873 CAGTTTCCCCTTGTGCAGTTTGG + Intronic
1134379740 16:13713029-13713051 CTGTGTACAGTTGTGCAGGTTGG - Intergenic
1137305656 16:47197170-47197192 CAATCTCCAATTATGCAGCTAGG + Intronic
1137312988 16:47285282-47285304 CAATCTCCACTTGTTCAGCTCGG - Intronic
1137730139 16:50683619-50683641 CTGCCAGCACTTGTACAGCTCGG - Intergenic
1138174119 16:54880644-54880666 CTGTGTCCATTTGTGGAGCTTGG - Intergenic
1139160295 16:64497953-64497975 CTGCCTACTCTTGTGCATCTTGG - Intergenic
1141845570 16:86606169-86606191 CTGTTCCCACTGGTGCAGGTGGG + Intergenic
1141881201 16:86860830-86860852 CTGTCTCCATTTCTACAGTTGGG + Intergenic
1142239619 16:88939281-88939303 CTGTCACCACCTGTGAAGCCAGG - Intronic
1143084296 17:4404227-4404249 CTGTGTCCACTCCTGAAGCTGGG + Intergenic
1143559502 17:7684489-7684511 CTGTCTCCACTTGTTGAAATAGG - Intronic
1144190567 17:12841707-12841729 CTTTCTCCACTTGTGACCCTGGG + Intronic
1145294613 17:21578374-21578396 CTGTCTACACTAGGGCAGGTGGG - Intergenic
1145369222 17:22294800-22294822 CTGTCTACACTAGGGCAGGTGGG + Intergenic
1146226116 17:31067552-31067574 TTGTTTCCACTTGGACAGCTTGG + Intergenic
1146259195 17:31410710-31410732 CTGTTTCCACTGTTGCTGCTGGG + Intronic
1147543511 17:41380595-41380617 CTATCTCCTCTTGGGCAGCCTGG + Intronic
1150609107 17:66719008-66719030 ATGTCTGTCCTTGTGCAGCTGGG + Intronic
1153331931 18:3882415-3882437 CTCTCCCCACTTGAGTAGCTGGG - Intronic
1154020993 18:10663870-10663892 ATGTCTCCACGTCTGCAGCATGG - Intergenic
1164478411 19:28592744-28592766 CTGTCTCCACCTGTCCAGGAGGG + Intergenic
1165973824 19:39657144-39657166 CTGCCCCCTCTTGTGTAGCTGGG - Intronic
1165979215 19:39705724-39705746 CTGCCCCCTCTTGTGTAGCTGGG - Exonic
925146204 2:1584857-1584879 CTATCTCCATTTGCGCAGCCGGG - Intergenic
925628728 2:5867430-5867452 CTGTCTGGACCTCTGCAGCTTGG - Intergenic
927522387 2:23707211-23707233 CTGGCTCCGCGTGGGCAGCTGGG - Exonic
927902270 2:26829096-26829118 CTGTCTCCACAGGAGCAGCGGGG + Intergenic
930411738 2:51032749-51032771 CTGGCTTTACTTGTGCACCTTGG + Intergenic
931496840 2:62816938-62816960 CTGTTTCCATTTGCACAGCTGGG - Intronic
932145905 2:69316685-69316707 TTGTTTCCACTGGTGCAGTTGGG + Intergenic
932365376 2:71148925-71148947 CTGGCTCCTCTTGTGCTGTTAGG + Intronic
932823658 2:74921706-74921728 CTTTCTCCACTTCTTCACCTGGG + Intergenic
936310187 2:111377233-111377255 CTGTCTCCACCTGCGGAGCAGGG - Intergenic
936845091 2:116821506-116821528 CTGTCTCCACTCGTGAAGGAAGG + Intergenic
937521664 2:122720315-122720337 ATTTCCCCACTTCTGCAGCTGGG - Intergenic
938777457 2:134554484-134554506 CTGTCTCCACCTGTGCTCCTAGG + Intronic
939229303 2:139406176-139406198 CTGTGTCCACGTGAGCATCTTGG + Intergenic
939722139 2:145667154-145667176 CTGTCTCCTCTTGGCAAGCTTGG - Intergenic
943462078 2:188181513-188181535 CTTTATCCACACGTGCAGCTAGG - Intergenic
943561134 2:189463828-189463850 TTGTCACCACTTCTGCAGATAGG + Exonic
944414087 2:199466461-199466483 CTCTCTCAACTTGGTCAGCTTGG - Intronic
946415116 2:219536355-219536377 CAGTCTACACTTGTGGAGCGTGG + Intronic
947462045 2:230311821-230311843 CTGTCTCCTCTGGGGCAGGTGGG - Intronic
947471127 2:230402033-230402055 CTGTCTCCTCTGGGGCAGGTGGG - Intronic
948151814 2:235750557-235750579 CTGCCTGCACTTGTGCATGTGGG + Intronic
948296324 2:236863370-236863392 CTGTGTCCTCTTGTGCTTCTGGG + Intergenic
948590171 2:239044290-239044312 CTGTCTCCACTTGGACAGGTGGG + Intergenic
1172512756 20:35511985-35512007 CTGTCTCCACTTGTGCAGCTGGG + Exonic
1174523786 20:51155383-51155405 CTCTCTTCTCTTGTGCAGCTTGG + Intergenic
1174953860 20:55074482-55074504 CTATCTCCACCTGTGCCTCTTGG - Intergenic
1175954529 20:62602602-62602624 CTGTTTCCACTTTAGCAGCCAGG + Intergenic
1176246424 20:64099409-64099431 CCGACTCCACCTGTGCAGCCGGG + Exonic
1176274810 20:64258588-64258610 CTGTCTCCAGTTGTGTACGTGGG + Intronic
1176882709 21:14216422-14216444 CTGTCTCCAGGTGAGCGGCTGGG + Intronic
1179506058 21:41842212-41842234 CTGTTTTCTCTTTTGCAGCTAGG - Intronic
1181280233 22:21714480-21714502 CTCTGTCCCCATGTGCAGCTGGG + Intronic
1183341525 22:37284382-37284404 CTGTGTCCATTTGCACAGCTGGG - Intronic
1183828470 22:40405864-40405886 CTGGCTCCCATTCTGCAGCTTGG + Intronic
1184817825 22:46885376-46885398 CTGTCTCCTCGTCTGCAGATAGG + Intronic
950505099 3:13389600-13389622 CTGTCTCCACAAGGGCAACTCGG + Intronic
952103582 3:30043405-30043427 ATGTCTGCACTTGTGCTGCTGGG + Intergenic
952844474 3:37675457-37675479 CTGTCTCCAGCTCTGCATCTGGG + Intronic
953096683 3:39783768-39783790 CTGGCTCCTCTCCTGCAGCTGGG + Intergenic
953507711 3:43502498-43502520 CTGTTTCCACTTGTGGTGCAAGG - Intronic
954393208 3:50278343-50278365 CTGTCTGCCCTTGTGGAGATGGG + Intergenic
955325958 3:58009351-58009373 CTGTCTCCACCTGGGCAGGGAGG - Intronic
955582626 3:60440819-60440841 CTCTCTCCAGTTGCTCAGCTTGG + Intronic
956495050 3:69816009-69816031 GTCTCTCCACTTCTGCAGGTTGG + Intronic
960599103 3:119437645-119437667 CTGTCTCCCCTTTGGCAGCCTGG - Intronic
960701453 3:120443177-120443199 AAGACTCCACTTGGGCAGCTGGG - Intronic
961445159 3:126977041-126977063 CTGTGTCCACATGTGTAGATGGG + Intergenic
961736934 3:129008152-129008174 CTCTCACTACCTGTGCAGCTAGG - Intronic
962827883 3:139113285-139113307 CTGGGTCCACTTGTGCAGAAGGG - Intronic
966429348 3:179814983-179815005 CTGGCTTCACTTGTGCAGAAAGG + Intronic
966558658 3:181293366-181293388 CAGTCTCCACTTTTGCAGAATGG + Intergenic
968783161 4:2598723-2598745 CTGTGTCCTGTTGTGCACCTGGG + Intronic
970453273 4:16193711-16193733 CTGTCTCCACTTGGGCAGCAGGG + Intronic
975657670 4:76657896-76657918 CTGTCTCCACTTGACCAGAAGGG - Intronic
975687267 4:76929748-76929770 CTGCCTCCCCAAGTGCAGCTTGG - Intergenic
981102834 4:140849345-140849367 CTGTCTTCATTTGTGCTTCTGGG + Intergenic
982514418 4:156326866-156326888 CTTTCTAGACTAGTGCAGCTGGG - Intergenic
984024065 4:174522273-174522295 CTGTCTCCGCCAGTGCACCTCGG + Intronic
985985368 5:3511094-3511116 CTTTCTCCACTTGTGAAGGATGG + Intergenic
986144684 5:5066277-5066299 CTGGCTCCAGGTGTGCATCTAGG - Intergenic
986684430 5:10263730-10263752 CTGTAGCCACTTGTGTAGCTCGG + Intronic
993150290 5:84153407-84153429 CTGTCTCCTCCTGAGTAGCTGGG + Intronic
993391794 5:87327246-87327268 CTGCCTACATTTGCGCAGCTAGG + Intronic
995594612 5:113734461-113734483 CACTCTTCACTTGTGCAGCTTGG - Intergenic
999694531 5:154177085-154177107 CTGTCTCAGCCTGTGTAGCTGGG - Intronic
1000097769 5:157986414-157986436 CTTCCTCCACTTGTGCTGCTTGG - Intergenic
1001790751 5:174455837-174455859 CTGACTCCATTTTAGCAGCTAGG + Intergenic
1002326912 5:178415712-178415734 CTGCATCCCCTTGTGCAGCAGGG - Intronic
1003488744 6:6602199-6602221 ATGTATCCACTTGTTCAGTTTGG + Intronic
1007064899 6:38980214-38980236 TTGTCTCCCCTTTTGCACCTTGG - Intronic
1007104749 6:39275883-39275905 CTGTCTGCACTTGTGGAATTAGG + Intergenic
1011131401 6:84055294-84055316 CTTTCTCCATTTGTGCAGGTCGG + Exonic
1015841935 6:137486623-137486645 CTGTCCCCAAATGTACAGCTGGG - Intergenic
1017552537 6:155524497-155524519 CTTTCTCAACTTGTGAAACTAGG + Intergenic
1018920154 6:168166937-168166959 CTGGCTTCACCTGTGCAGCATGG - Intergenic
1019374990 7:684755-684777 CTGTCTACTCTTGTGTAGTTTGG - Intronic
1019852493 7:3573523-3573545 CAGCCTCCACGTGTGCACCTCGG + Intronic
1021243802 7:18237084-18237106 CTTTTTCCACTGGTGCAGGTTGG + Intronic
1021502904 7:21349679-21349701 CTGTCTCCCCCTGAGTAGCTGGG + Intergenic
1021927234 7:25545423-25545445 CTGGCTCCATTTGTCCTGCTGGG - Intergenic
1023055348 7:36285941-36285963 CTGTCTGCACATGTACACCTGGG + Intronic
1023644334 7:42293568-42293590 ATGCCTCCACTTGGTCAGCTGGG + Intergenic
1023688847 7:42765035-42765057 CAGTCTTCACTTGCGCATCTGGG - Intergenic
1024534794 7:50421252-50421274 CTGGCTGCACCTGGGCAGCTTGG - Intergenic
1024816459 7:53276911-53276933 CTGTCTCTGCTTGTGCTGATAGG + Intergenic
1027359656 7:77394805-77394827 CTGCCTACACATGTACAGCTTGG - Intronic
1030067800 7:105673749-105673771 CTGTCTCCATTTCCACAGCTGGG - Intronic
1031682911 7:124696243-124696265 CAGTCTCCTCTTGTACAACTGGG - Intergenic
1033057541 7:138073028-138073050 CTTTACCCACTTGAGCAGCTGGG - Intronic
1034341818 7:150362086-150362108 CTGTCTCCACTTAACCAGCTTGG - Intergenic
1034883010 7:154776596-154776618 CTGGCTCCAGTTCTGCAGCAGGG + Intronic
1035867482 8:3100542-3100564 GTGTCTCCACTTGGGAATCTGGG + Intronic
1036397268 8:8379877-8379899 CTGTTTCCAATTTTGAAGCTTGG - Intronic
1039372538 8:37001330-37001352 CTTTCACCACGTGGGCAGCTTGG + Intergenic
1039393717 8:37204595-37204617 CTGTCTCCACTTCTGCCTCTAGG + Intergenic
1044384796 8:91575024-91575046 CTGTAGGCACTTGTGCTGCTGGG + Intergenic
1049017941 8:139934658-139934680 CTGTGGCCACATGTGCAGCCTGG - Intronic
1049443748 8:142620662-142620684 CTGTCTCCCCATGTGCACCCAGG - Intergenic
1050489204 9:6169744-6169766 CTGTCTTTACTGGTGCAGTTAGG - Intergenic
1052352964 9:27475889-27475911 CTGCCTCCACTTCTGCTCCTCGG + Intronic
1052672823 9:31580189-31580211 ATGTCTCCACTCATGGAGCTTGG - Intergenic
1053274337 9:36771850-36771872 CTGTCTCCCCTTATTCATCTGGG + Intergenic
1055281727 9:74681967-74681989 ATGACTCCACTTTTGGAGCTTGG + Intronic
1056735321 9:89204768-89204790 CTGTCTCTCCTGGAGCAGCTGGG + Intergenic
1057022070 9:91707061-91707083 CTGTTTCCAGGTGTGTAGCTGGG + Intronic
1057928145 9:99170897-99170919 CCCTCCCCACTTGTGCAGTTGGG + Intergenic
1058451178 9:105097926-105097948 CTACCTCAACTTGTGCAGTTTGG - Intergenic
1059332245 9:113542913-113542935 CAGTCTCCACTAGAGCTGCTAGG - Intronic
1059413427 9:114148688-114148710 CTGTGTCCACTTGTAAAGGTGGG + Intergenic
1059844756 9:118262473-118262495 CTGTCTCCACTTTCTCAGTTTGG - Intergenic
1059855466 9:118392547-118392569 GTGTCACCACTGGGGCAGCTAGG - Intergenic
1062263432 9:135675160-135675182 CTCTCCCCACCTGTGCAGGTCGG + Intergenic
1193781379 X:85706133-85706155 TTGTCTCCACTTTTACAGATGGG + Intergenic
1197595392 X:128457894-128457916 CTGTTTCAACTTGTCCAGCATGG + Intergenic
1198541785 X:137647840-137647862 GTTTCTCTACTTGAGCAGCTGGG - Intergenic
1199401428 X:147403809-147403831 CTGTATCTAATTGTACAGCTCGG - Intergenic