ID: 1172513194

View in Genome Browser
Species Human (GRCh38)
Location 20:35514750-35514772
Sequence TGCCAAAGGCTGTCTGCGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 126}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172513194 Original CRISPR TGCCAAAGGCTGTCTGCGCC AGG Exonic
900348589 1:2224177-2224199 TGCCAATGGCAGTCTATGCCTGG + Intergenic
902679222 1:18031247-18031269 TGCCAAAGGCTCACTGGCCCCGG + Intergenic
905827018 1:41033527-41033549 TGCCATAGGCTGTCTGCAGAGGG - Intronic
918415238 1:184299212-184299234 TGCCAAAAGCCATCTGCACCTGG - Intergenic
920792746 1:209108200-209108222 TGACAAAGTCTGTCTGGTCCTGG - Intergenic
922461051 1:225814677-225814699 GGCCAATGGCTGCCTGCTCCTGG - Intronic
924294185 1:242568870-242568892 AGCCAATGGCTGCGTGCGCCAGG + Intergenic
1063881402 10:10536306-10536328 TTCCAAAAGCTGTCTGGGCATGG - Intergenic
1065225648 10:23541365-23541387 TGGCAAAGGCTGCATGTGCCCGG + Intergenic
1065937028 10:30529696-30529718 TGCCAGTGGCTGGGTGCGCCTGG + Intergenic
1070327152 10:75396576-75396598 GGCCAAAGGCTGACTTCGCGCGG + Intergenic
1074402425 10:113153001-113153023 TGCCAAAGGCTGACTTCCTCTGG - Intronic
1074673798 10:115825756-115825778 GGCCAAATGCTGTCTTCTCCTGG + Intronic
1075515024 10:123101723-123101745 TGACAAATGGTGTCTGCGCGCGG - Intergenic
1075846825 10:125551636-125551658 GCTCAAAGGCTGTCTGCACCAGG + Intergenic
1076197576 10:128530962-128530984 TGCCAAAGTCTGTCTTTGCATGG - Intergenic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1078325320 11:10375864-10375886 AGCCAAAGGGTGTCTGCTCCAGG + Intronic
1082902879 11:58275285-58275307 TGCCAATGGCTGTCTTTTCCCGG + Intergenic
1084220542 11:67674921-67674943 TGGCAAATGCTGCCTTCGCCAGG + Intronic
1085277654 11:75310277-75310299 GGCCAACGTCTGTATGCGCCTGG + Intronic
1087073025 11:94100421-94100443 TGCCACAGGCCCTCTGAGCCAGG + Intronic
1089796022 11:120981827-120981849 TACCAAAGGGTGTCTGGGGCTGG - Intronic
1091821945 12:3481951-3481973 TGCCAAAGTCTGTCTGCAAAAGG + Intronic
1091961784 12:4701701-4701723 TGCTAAAGGCTCTCTGCTTCAGG - Intronic
1094289038 12:28825516-28825538 AGCCAAAAGCTCTCTGCGTCTGG - Intergenic
1097262586 12:57727870-57727892 TGCCAATGGCCGTCAGCACCAGG + Intronic
1106280266 13:28261211-28261233 TGTCTAAGTCTGTCTGGGCCTGG + Intronic
1112301537 13:98235274-98235296 TGCCCAAGGCTGTGGGCCCCAGG + Intronic
1116512519 14:45764553-45764575 TGCCAAAAGCTGTGTGAGCTTGG - Intergenic
1117956828 14:61129634-61129656 TGCCAAAGGATGAGTGCACCCGG + Intergenic
1121206422 14:92172374-92172396 TCCGAAATGCTGTCTGAGCCAGG + Intergenic
1122797312 14:104212513-104212535 TGCCAGGGGCTGTGTGTGCCAGG - Intergenic
1125511185 15:40293261-40293283 TGTCAAGGGCTATCTGTGCCAGG - Intronic
1128304878 15:66591826-66591848 TGCAGGAGGCTGCCTGCGCCAGG - Intronic
1129481820 15:75832654-75832676 TGCCAAAGGGTGAATGCCCCTGG + Intergenic
1129825384 15:78631402-78631424 TGCAAAAGGCTGTGAGCTCCAGG + Intronic
1129934194 15:79435769-79435791 AGCCAAAATCTGTCTGTGCCAGG - Intronic
1130910780 15:88269552-88269574 TGCCAGGGGCTGTGTGTGCCAGG - Intergenic
1132318296 15:100906372-100906394 TGCCAAGGGCTTTCTGGGGCAGG + Intronic
1132485347 16:187432-187454 TGCCACAGGCTGTCCCCTCCAGG - Intergenic
1132945059 16:2527948-2527970 TGCCACGGGCCGTCAGCGCCCGG - Exonic
1136654922 16:31703882-31703904 TGCCAAGGGCTGAGTGCCCCAGG - Intergenic
1137740984 16:50773891-50773913 TGTCAAAGGCTGTCTGAGAGGGG - Intronic
1138382791 16:56615173-56615195 TGCCAAAGGCAGCATGGGCCTGG - Intergenic
1138597225 16:58035449-58035471 GGCCGAAGGCTGCCTGCCCCAGG + Intronic
1140825967 16:78706956-78706978 TTCCAAAGGCAGTTTGTGCCAGG - Intronic
1148776310 17:50097355-50097377 AGCCAAAGGATGTCTCGGCCAGG - Intronic
1150267177 17:63839058-63839080 TGCCAAAGTCTCTCTGCATCAGG + Intronic
1151767135 17:76138431-76138453 GGCCAGAGGCTGTCAGCGGCAGG - Intronic
1152112677 17:78365893-78365915 TGCCAGAGGCCGGCTGGGCCTGG - Intergenic
1152788678 17:82266134-82266156 TACCACAGGCTGTCTGGGGCGGG - Intronic
1153427959 18:4987442-4987464 TGCCAAAGTCTGGCTGAGTCCGG + Intergenic
1153647127 18:7205291-7205313 TGCCCAAGGCTGTGTGTGTCTGG + Intergenic
1153880529 18:9418235-9418257 AGCCCGAGGCTGTCTGTGCCTGG - Intergenic
1155242033 18:23872926-23872948 TGAGGAAGGCTGTCTGCGGCAGG - Intronic
1155354073 18:24934797-24934819 AGCGAAAGGCTGTATGCACCAGG + Intergenic
1156028478 18:32685136-32685158 TGCCATGGTCTGTCGGCGCCCGG - Intronic
1161054940 19:2186108-2186130 TGGCAAAGGCTGTCAGAGGCCGG + Intronic
1161223943 19:3133633-3133655 TGCCAATGGCTGTGTGGCCCTGG + Intergenic
1163413419 19:17171237-17171259 TGGCAAATGCTGCCTGAGCCCGG - Intronic
925853714 2:8108992-8109014 TGCCATAGGATCTCTGGGCCTGG - Intergenic
927073776 2:19556118-19556140 TGGCAAAGGCTAACTGAGCCAGG + Intergenic
927458909 2:23280606-23280628 TGCCCAAGGCCCTCTGCACCTGG - Intergenic
930448988 2:51510693-51510715 TGCCTAAGGCTGCCTGCTTCTGG - Intergenic
931449919 2:62359946-62359968 TGACAAAGTCTGTCTGGGCATGG + Intergenic
937236230 2:120433242-120433264 TGCCACAGGCTGCGTGCCCCTGG - Intergenic
943035373 2:182738432-182738454 GGTCAAAGGCTGTCTGAGACAGG + Intronic
946450820 2:219777562-219777584 TTCCACATGCTGTCTGCTCCAGG - Intergenic
948558393 2:238834070-238834092 TGCCGAAGCCTGCCTGCTCCAGG - Intergenic
1168794491 20:602565-602587 TGCCAGAGGCTGGCTGTACCTGG + Intergenic
1169791424 20:9414290-9414312 TGGCAAAGGCTGTCAGTGACAGG + Intronic
1169794624 20:9448407-9448429 TACCAAGGGCTGTTTGGGCCAGG - Intronic
1172513194 20:35514750-35514772 TGCCAAAGGCTGTCTGCGCCAGG + Exonic
1172702725 20:36863035-36863057 TGCCAAGGGCCGTCCGCGCTCGG - Exonic
1172900880 20:38334007-38334029 TTCCAAAGCCTGTGTGTGCCTGG - Intronic
1175117822 20:56695502-56695524 ACCCAAAGGCCGTCTGCGGCAGG + Intergenic
1176011058 20:62895855-62895877 TGGAAAAGGCTGTCTGAGGCCGG + Intronic
1177587584 21:23118518-23118540 TTCTAGAGGCTGTCTGTGCCTGG + Intergenic
1180137870 21:45872727-45872749 TGGCAAGGGCTGTCTGTGCCTGG + Intronic
1181987022 22:26806903-26806925 TGTCAAAGGCAGCCTGAGCCTGG + Intergenic
1184611803 22:45608741-45608763 TGCCAAAGGCTTTCTCTGCTGGG - Intergenic
950177634 3:10886354-10886376 TGCCCAAGGCTGTATGGGACAGG - Intronic
953387627 3:42515428-42515450 TGCCAAAGCCTGTCTGCACCTGG - Intronic
954239866 3:49285089-49285111 TGCCAAAGGCTTTTTGGGGCTGG - Intronic
960790930 3:121430155-121430177 TTCCAAAGGCTGTCTGTGATTGG - Intergenic
962314183 3:134348762-134348784 TGCACAAGGCTGTCGGCCCCTGG + Intergenic
967719647 3:192802116-192802138 TGCAAAGGGCTGTCTTAGCCAGG + Intronic
967917556 3:194589993-194590015 TGACAAAGGCTGTGTCTGCCTGG + Intronic
968764239 4:2459739-2459761 TGCAAACGGCTGTCTGCCCCAGG + Intronic
969716474 4:8870569-8870591 TGCCCCAGGCTGTCTGCAGCGGG + Intronic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
976376715 4:84353636-84353658 TGTCAAAGGCTGTCAGCACTAGG - Intergenic
979010811 4:115366002-115366024 TGACAAAGTCTGGCTGAGCCTGG - Intergenic
984522941 4:180823288-180823310 AGTCAAAGGCTGTTTGAGCCTGG + Intergenic
984656724 4:182326573-182326595 TGCCAAAGCCTGACTGCAGCGGG + Intronic
985517580 5:354814-354836 TGCAAGAGGCTGTCAGTGCCTGG + Intronic
986192126 5:5507416-5507438 TGCCCAAGGCTGACTGCAGCAGG + Intergenic
986301312 5:6480386-6480408 TGTCGAGGGCTGTCTGAGCCAGG - Intronic
987011582 5:13771400-13771422 TGCCAAATGCAGTCAGAGCCAGG - Intronic
988834041 5:35014101-35014123 TTCCAAATCCTGTCTGCACCTGG + Exonic
999786950 5:154899273-154899295 TGCCAAGGCCCGGCTGCGCCCGG - Exonic
1002607050 5:180389712-180389734 AGTCAGAGGCTGTCTGAGCCGGG + Intergenic
1003110634 6:3249655-3249677 TGCAACAAGCTGTCTGTGCCTGG + Intronic
1004097893 6:12577530-12577552 TTTCAGAGGCTGTCTGCCCCAGG + Intergenic
1006985899 6:38175326-38175348 TGCCATCAGGTGTCTGCGCCGGG - Intronic
1011590059 6:88963347-88963369 TGCCACCGGCTGGCCGCGCCGGG + Exonic
1016244210 6:141963687-141963709 AGCCTAAGGCTCTCTGAGCCAGG + Intergenic
1016765863 6:147793115-147793137 TGACAAACACTGTCTGAGCCAGG + Intergenic
1017594484 6:156014046-156014068 TGCCGAGGGCTGTCAGCGCTGGG - Intergenic
1018959799 6:168440554-168440576 TGCCAAAGGCGGGCTGCCCCCGG + Intergenic
1020035926 7:4963082-4963104 TACCAGTGGCTGTCTGAGCCTGG - Intergenic
1021876400 7:25053709-25053731 TGCCAAAGTCTGCCTGCCTCAGG - Intergenic
1022488715 7:30800351-30800373 TGGGAAAGGCTGTCTGAGCCTGG - Intronic
1022663306 7:32386774-32386796 TTCCAAAGCCTGTGTGTGCCTGG - Intergenic
1023028670 7:36074482-36074504 TGCCACAGGCTGACAGGGCCTGG - Intergenic
1024374989 7:48627089-48627111 TGCCAAATGCTTTCTGTGCATGG + Intronic
1024970300 7:55063065-55063087 TTCCAAAGTCTGCCTGCTCCAGG + Intronic
1030721904 7:112881270-112881292 TGCCAAGGGGTGCCTGCACCAGG - Intronic
1034965598 7:155388839-155388861 AGCCAAAGGCAGTCTGCAGCCGG + Intronic
1036579466 8:10060140-10060162 TGCCAAATGATGACTGCACCAGG + Intronic
1038407518 8:27333076-27333098 TGCCAAATGCCGTCTCCTCCAGG - Intronic
1039880957 8:41625354-41625376 TGACAAAGGGTGCCTGCCCCAGG - Intergenic
1042977308 8:74483853-74483875 TGCTAAAGGCTGTGTGTCCCAGG + Intronic
1043921150 8:85984732-85984754 TCCCAAATGCTGTCTGCTGCGGG + Intergenic
1049476477 8:142799343-142799365 TGCCAGAGGCTTTCGGCCCCTGG + Intergenic
1053146908 9:35718217-35718239 TCCCAAAGCCTGGCTTCGCCAGG + Intronic
1057565233 9:96160936-96160958 TGCCAAAGACTGCCTGCTCCAGG - Intergenic
1057829995 9:98398994-98399016 TGCAATAGGCTGTCTGCCCCAGG + Intronic
1058271740 9:102981271-102981293 TGCCAAAGGCTTTATGGGTCTGG - Intergenic
1059064621 9:111070120-111070142 TGCAAAAGACTTTCTGGGCCGGG + Intergenic
1059685572 9:116632509-116632531 TGTGAAAGGCTGTGTGTGCCAGG - Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1186144819 X:6614289-6614311 ATCCCAAGGCTGTCTGGGCCTGG - Intergenic
1195459820 X:105111707-105111729 TCCCAAAGACTGTCATCGCCAGG - Intronic