ID: 1172518770

View in Genome Browser
Species Human (GRCh38)
Location 20:35554058-35554080
Sequence CTTTGCAAAGGGCTGTCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 141}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172518770_1172518775 0 Left 1172518770 20:35554058-35554080 CCTTAGGACAGCCCTTTGCAAAG 0: 1
1: 0
2: 2
3: 21
4: 141
Right 1172518775 20:35554081-35554103 GAGAACACTGAGGCCCAGAAAGG 0: 1
1: 21
2: 241
3: 1475
4: 5018
1172518770_1172518776 1 Left 1172518770 20:35554058-35554080 CCTTAGGACAGCCCTTTGCAAAG 0: 1
1: 0
2: 2
3: 21
4: 141
Right 1172518776 20:35554082-35554104 AGAACACTGAGGCCCAGAAAGGG 0: 1
1: 6
2: 85
3: 551
4: 2007
1172518770_1172518779 19 Left 1172518770 20:35554058-35554080 CCTTAGGACAGCCCTTTGCAAAG 0: 1
1: 0
2: 2
3: 21
4: 141
Right 1172518779 20:35554100-35554122 AAGGGCAACTGATTTGCCCAAGG 0: 1
1: 1
2: 10
3: 118
4: 752
1172518770_1172518774 -10 Left 1172518770 20:35554058-35554080 CCTTAGGACAGCCCTTTGCAAAG 0: 1
1: 0
2: 2
3: 21
4: 141
Right 1172518774 20:35554071-35554093 CTTTGCAAAGGAGAACACTGAGG 0: 1
1: 1
2: 20
3: 210
4: 1482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172518770 Original CRISPR CTTTGCAAAGGGCTGTCCTA AGG (reversed) Intronic
900710600 1:4111035-4111057 ATAGGCAAAGGGCTGTCCTGTGG + Intergenic
900775942 1:4585542-4585564 CTTTCCAAAGGACTTTCCCAAGG + Intergenic
901441075 1:9278843-9278865 CTTTGTCAAGGGCTGTGCCAAGG + Intergenic
902918039 1:19650562-19650584 CTCTGCAAGGGGCTGTCCCAAGG - Intronic
903229182 1:21911557-21911579 CTGGGTAAAGGGCTGTGCTATGG - Intronic
904822686 1:33256031-33256053 CTGGGGAAGGGGCTGTCCTAGGG + Intergenic
906256689 1:44355789-44355811 ATTTGTGAAGGGCCGTCCTAAGG + Intergenic
907406505 1:54256896-54256918 CTCTGGAATGGGCTGTCCAAAGG + Intronic
908358319 1:63343857-63343879 CTTTTAATAGGACTGTCCTACGG + Intergenic
909841164 1:80326449-80326471 TGTTGCAAAGAGCTGTCCTGAGG - Intergenic
913340737 1:117755718-117755740 CTTTTCATAGGGCTGTCCTGGGG - Intergenic
915685153 1:157625189-157625211 CTTTGGAAAGAGCTCTGCTATGG + Intergenic
916187290 1:162145649-162145671 CTTTCCAAAGGACTGTCCAAAGG - Intronic
916251336 1:162741535-162741557 GTTTGCAAAGTGCTGTCCCATGG - Intronic
916675245 1:167059769-167059791 TTTTTCAAAGGGCAGTACTAAGG + Intronic
917121482 1:171648264-171648286 CTTGGCCAAGGGCTATCCCATGG - Intronic
917962827 1:180158013-180158035 CTTAGCAAAGTGCTGGCATAAGG - Intronic
917973118 1:180221024-180221046 CATTGCACAGCGCTGTTCTAGGG - Intergenic
918524209 1:185447287-185447309 ACATGCAAAGGGCTGTCCTGGGG + Intergenic
918699584 1:187591109-187591131 ATTTGCATAGGGCTCACCTATGG + Intergenic
919167200 1:193910557-193910579 CTTTGCACAGTGCGTTCCTATGG + Intergenic
920098952 1:203504854-203504876 CTTTGCACAAGGCTGCCCTCTGG - Intronic
1063254311 10:4309313-4309335 CTTTGCAAAGGGCTGGTTTCTGG + Intergenic
1063266161 10:4453463-4453485 CTTCTCCAAGGACTGTCCTAGGG + Intergenic
1065245537 10:23752850-23752872 CTTAGCACAGGGCTGCCCTGTGG - Intronic
1072414638 10:95237004-95237026 CTTTGCATTGGGCTGTTCTGAGG - Intergenic
1074442392 10:113489943-113489965 CTGTTCACAGGGCTGTCCCATGG - Intergenic
1074782029 10:116809015-116809037 CTTCCTAGAGGGCTGTCCTATGG + Intergenic
1078587061 11:12601007-12601029 CTTTGCAAAGGGCTATGACATGG + Intergenic
1078746543 11:14120783-14120805 CTGTGCTAAGGGCTGTAATATGG + Intronic
1079352921 11:19708177-19708199 CTTTCCAAAGAGATGTCTTAAGG + Intronic
1079836979 11:25347823-25347845 ATTTGCAAAGGACTGTTTTATGG + Intergenic
1080537060 11:33231834-33231856 CTCTGCAAAGGGCTCTACAAAGG + Intergenic
1080640576 11:34156038-34156060 CTTTGCTAAGGGATGGCCTCAGG + Intronic
1081152039 11:39644796-39644818 TTTTCCACAGGGCTGTTCTAAGG - Intergenic
1083682671 11:64358664-64358686 CCTTGCAAAGGCCAGTCCTCTGG + Intergenic
1083986373 11:66218407-66218429 CATTGCAAAGCTCTGTCTTATGG - Intronic
1084319410 11:68365188-68365210 CTTTGCAGAGGGGTGTCCTTTGG + Intronic
1086528589 11:87757612-87757634 CTTTGCAAATGCCTGTCCTTTGG - Intergenic
1088237607 11:107742171-107742193 CTCTCCAAAGATCTGTCCTAAGG + Intergenic
1089340323 11:117752941-117752963 CTTTGCCCATGGCTGTCCCAGGG + Intronic
1090187878 11:124750163-124750185 CTATCCAAAGGGCTGTCATGTGG - Intronic
1090193412 11:124793690-124793712 TATTGGACAGGGCTGTCCTAGGG + Intronic
1091614495 12:2039086-2039108 ATTTGCAAAGGGCTGTCTGTTGG - Intronic
1091822421 12:3486005-3486027 CTTAGCATAGGGCTGACCTCTGG - Intronic
1092735413 12:11577878-11577900 CTCTGCAAAGGGTTGCCCTTGGG - Intergenic
1093115669 12:15207789-15207811 TTTTGTGAAGGGCTGTCATAAGG + Intronic
1096765981 12:53890141-53890163 CTATTATAAGGGCTGTCCTAAGG + Intergenic
1098772362 12:74568485-74568507 CTTTGTAAAGAGCTGTGTTAGGG - Intergenic
1099646870 12:85368544-85368566 ATTTGCAAAGAGATATCCTAGGG + Intergenic
1100752361 12:97712765-97712787 TTTTAAAAAGGGCTATCCTAAGG + Intergenic
1100944754 12:99768904-99768926 GTTTGCAGAGGGCTGTCTTCTGG - Intronic
1104498906 12:129266221-129266243 CTTAGCTAATGGATGTCCTACGG + Intronic
1105721347 13:23118018-23118040 CTTTGCAAAGAGCATTCCTCAGG + Intergenic
1105978651 13:25496082-25496104 CTTTGAAAGGTGCTGTCCTGTGG + Intronic
1106635036 13:31519583-31519605 CTTTGCTAAGGGTTTTCCTAAGG + Intergenic
1117253942 14:53959554-53959576 CTTTGAAAAAGGCTGTCCCAAGG - Intergenic
1118403417 14:65400583-65400605 CTTTCCAAATGGCTGTCTTAAGG + Intergenic
1121364854 14:93299789-93299811 CTTTGGAAAATGCTGGCCTAGGG - Intronic
1126439040 15:48667556-48667578 CTTTGCAAAGCACTGCTCTATGG + Intergenic
1126892175 15:53218325-53218347 ATTGGCTAAGGGCTGTCCCATGG + Intergenic
1128333850 15:66773715-66773737 CTTTGCACAGGGCTGCACTGAGG - Intronic
1133000594 16:2849618-2849640 CTCTGCAAAGGGCTGTTCCATGG + Intergenic
1133251663 16:4486237-4486259 GTTTACAAAGGAATGTCCTAGGG - Intronic
1133505500 16:6408298-6408320 CTTTACAGAGGTCTGTCTTAAGG + Intronic
1134054279 16:11159558-11159580 GTTTGAAAAGGGCTGTCATAGGG + Intronic
1134659621 16:15974191-15974213 CTTTGGAAAGGGCTGTGCTTTGG + Intronic
1138366546 16:56483312-56483334 ATTTGACAAGGGCTGTCCTAGGG - Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1143353729 17:6308800-6308822 CTTTGCCAAGGGCTCTGCTCAGG - Intergenic
1147931213 17:43982857-43982879 CTTTGGTAAGGGGTGTTCTAAGG + Intronic
1152315638 17:79578848-79578870 CTTTGCCCAGGGCTGACCTCAGG + Intergenic
1153212509 18:2783316-2783338 CTTTGAGAAGGGCTGTCCCAGGG + Intronic
1154310776 18:13264661-13264683 CTCTGCAAATGGCTGTTCTTTGG + Intronic
1155346684 18:24864254-24864276 CTTTGCAAAGTGTTGTCCTATGG - Intergenic
1156485854 18:37465131-37465153 CCATGCAAAGAGCTTTCCTAAGG - Intronic
1159079425 18:63720673-63720695 CTTTGCAAAGGGAAGTAATAAGG + Intronic
1164295276 19:23904301-23904323 TTTTGCAAAGTGCTTTTCTATGG - Intergenic
1165076929 19:33284688-33284710 CCCTGCAAAGGCCTGTCCTCGGG + Intergenic
1167217991 19:48177653-48177675 CGGAGCAAGGGGCTGTCCTAGGG + Intronic
1168710533 19:58497623-58497645 ATATGCAAAGGGCTGTCCGTGGG - Intronic
925556343 2:5134919-5134941 CTTTGCTGAGGGCTATTCTATGG + Intergenic
926236631 2:11050332-11050354 CCTTGCAGAGGGCTGTCACAAGG + Intergenic
927289915 2:21395261-21395283 CTTTGAAAAGGGAAGCCCTAGGG - Intergenic
930104955 2:47632327-47632349 CTTTGCAAAGGGTGGTGATAAGG - Intergenic
932090951 2:68805817-68805839 CTTTGCAAACGGATGTCCTAGGG + Intronic
933807508 2:86011135-86011157 ATTGGCAGAGGGCTGACCTAGGG - Intergenic
937124168 2:119462695-119462717 CTTTGCATTGGGCTGTCCCCTGG + Intronic
937544642 2:123002290-123002312 CTTTGCCGAGGACTGCCCTATGG - Intergenic
941003630 2:160225780-160225802 TTTTGCAGAGTGCTGCCCTAGGG + Intronic
941168428 2:162108572-162108594 TTTCCCAAAGGGCTGTCCTCTGG + Intergenic
941714619 2:168750749-168750771 CTTTGCAAACATTTGTCCTATGG - Intronic
945833860 2:214815192-214815214 CATTGCAAAGGGATGTCCATTGG - Intergenic
946019319 2:216629996-216630018 CTCTGCAAAGGTATGTCCTCAGG - Intergenic
946144118 2:217715883-217715905 CTATTTAAAGGGCTGTCCTCAGG - Intronic
947861403 2:233361043-233361065 CTTTCCCCAGGGCTGCCCTAGGG - Intronic
1172498815 20:35410167-35410189 CTTTCCAAAGGGATGTTATAAGG + Intronic
1172518770 20:35554058-35554080 CTTTGCAAAGGGCTGTCCTAAGG - Intronic
1173950601 20:46990204-46990226 CTTTCCAAAGTACTGTCCTTAGG + Intronic
1174903464 20:54524950-54524972 TTCTCCAAAGGGCTGTCCTCTGG - Intronic
1175960744 20:62635055-62635077 CTTTGGATGGGCCTGTCCTAAGG - Intergenic
1178317767 21:31581083-31581105 CTGTGCAAAGTGTGGTCCTAGGG + Intergenic
1178582335 21:33847413-33847435 CTTTTCAAAGGGCAGGCCTGAGG - Intronic
1178885639 21:36482824-36482846 CTTTGCAGAGGTCTGACCTAAGG + Intronic
1179329548 21:40385743-40385765 CATTGCAAAGAGCTGTCAGAGGG - Intronic
1180045690 21:45304095-45304117 CTCAGGAAAGGGCTGTCCGAGGG - Intergenic
1184861614 22:47176041-47176063 CTTTGAAAAGGGCTGTTCCGGGG + Intergenic
950160339 3:10755949-10755971 CTTTGCGAAGTCCTGTCCCAAGG - Intergenic
952312068 3:32199321-32199343 CTTTGCCTAGAGCTGTCCTGGGG + Intergenic
952684215 3:36130904-36130926 GTCTGCAAAGGACTATCCTAAGG + Intergenic
953805058 3:46061630-46061652 ATTTTAAAAGGACTGTCCTAAGG - Intergenic
955991368 3:64631115-64631137 CTTTTCAAAAAGCTGTCCTGTGG - Intronic
960850801 3:122052085-122052107 CTTTTCAAAGGGCTGCCAAAGGG - Intergenic
961682865 3:128610625-128610647 CTCTGCAGAGGGCTGTCTTCCGG - Intergenic
961920956 3:130425832-130425854 CTTTTCAAAGGGCAGTGCCAAGG - Intronic
964095976 3:152932288-152932310 CTTTGCAAAGGACTGAGCTGTGG - Intergenic
965861329 3:173154448-173154470 TTTTGTTAAGGGCAGTCCTAGGG + Intergenic
966537328 3:181049356-181049378 ATTTGCACAGGGCTCTCCTCAGG + Intergenic
967210660 3:187165379-187165401 AGTTGCAAAGAGCTCTCCTAAGG + Intronic
967824660 3:193868870-193868892 ATTTGCAAAGGTCTGTCATAGGG - Intergenic
968183223 3:196612615-196612637 GTATGGAAAGGGCTGTCCCAAGG - Intergenic
969561448 4:7950693-7950715 CTTTGCTCTGGGCTGTCCTGAGG - Intergenic
971393207 4:26204977-26204999 CTTTCCAAAGGGATGTGCCAAGG + Intronic
977725343 4:100290233-100290255 TTTTGCCAAGGGCTGTTCCATGG + Intergenic
977849367 4:101807131-101807153 ATTTGCAAAGCACTGTCCCAGGG - Intronic
978649722 4:110985995-110986017 ATTTACAAAGGGCTTTCCCATGG - Intergenic
980859415 4:138481554-138481576 CTTTTCAAATGGCTGTTCAAAGG - Intergenic
981029852 4:140113363-140113385 CCTTGTAAAGGGCTGTGCAAGGG + Intronic
983361117 4:166724584-166724606 ATTTTCAAAGGGCATTCCTAGGG - Intergenic
983640076 4:169937141-169937163 CTTTGCAAATGGTTTTCCAAAGG - Intergenic
994934593 5:106238046-106238068 TCTTTCAAAGGGCTTTCCTAAGG - Intergenic
995693734 5:114856983-114857005 CTTTGCAAAGGTCAGTTCTAAGG + Intergenic
995810369 5:116100381-116100403 CATTGCAAAGGCCAGTGCTAAGG + Intronic
997368291 5:133339687-133339709 TTTACCAAGGGGCTGTCCTATGG - Intronic
997615996 5:135246605-135246627 CTGTTCACAGGGCTGTCCTAAGG - Intronic
998031639 5:138875073-138875095 CTTTCCAGAGGGATATCCTAAGG - Exonic
1001058034 5:168465354-168465376 CTTTGGCAAGGGCTGCCCTGTGG - Intronic
1005481462 6:26259177-26259199 TTTTGCAAAGTGCTTTTCTATGG - Intergenic
1007513766 6:42395104-42395126 CTTTGCAAAGGGCTCTTCTGAGG - Intronic
1011060267 6:83257852-83257874 CTTTGGAGAGTGCTGTCATATGG + Intronic
1018538231 6:164846920-164846942 CTTTGCAGAGGTCTGTCTTTGGG + Intergenic
1022548961 7:31218605-31218627 CTCTGCACAAGGCTGCCCTATGG - Intergenic
1032262532 7:130348502-130348524 CATCGCAAAAGGCTGACCTAGGG + Intronic
1036397876 8:8384292-8384314 CTTTGCACAGGGCTGTGCAAAGG - Intronic
1036810519 8:11865232-11865254 CTTTTCAATGGTCTGGCCTAAGG - Intronic
1038961300 8:32523185-32523207 AGTTGGAAAGGGATGTCCTAAGG - Intronic
1039860731 8:41454960-41454982 CATAGCTAAGGGCTGTCCTAGGG - Intergenic
1040639537 8:49317124-49317146 ATTTGGAATGGGTTGTCCTATGG + Intergenic
1042132796 8:65605458-65605480 CTTTTCAAATGGCTGTTCAAAGG - Exonic
1043720029 8:83536088-83536110 ATTTGCAAATGGCTTTTCTATGG + Intergenic
1045738979 8:105331914-105331936 ATTTGCAAAGGGATGTCCACTGG - Intronic
1051325448 9:15962220-15962242 CTTTACAAAGGTCTGACCTTTGG + Intronic
1060070503 9:120542913-120542935 CTTTACAAAGGGCTGAGCAATGG + Intronic
1060418069 9:123446859-123446881 CTTTACAAAGGGCTGTGAAATGG + Intronic
1061970778 9:134044091-134044113 CCTTGCAAAGGCCAGTCCTCTGG - Intronic
1186606663 X:11099671-11099693 CTTGGCATAGGGATGACCTAAGG - Intergenic
1187384127 X:18831908-18831930 CTTTGGAAATAGCTTTCCTAAGG - Intergenic
1187461087 X:19487327-19487349 CTTTCCAGAGGGCTTTGCTAAGG + Intronic
1193159679 X:78214523-78214545 TTTTGCAAAGTGCTTTTCTATGG + Intergenic
1193212658 X:78825957-78825979 CTTGGCAAAGAGCTGTCATTGGG + Intergenic
1195372447 X:104191346-104191368 CTTTGCCAAGGTCTGTGATATGG + Exonic
1195707475 X:107748468-107748490 CTTTGGGAAGGGCTGACCCAAGG - Intronic
1195940260 X:110161879-110161901 CTTTGAAAACAACTGTCCTAGGG - Intronic
1197334164 X:125191627-125191649 CTAGGCAAAGCACTGTCCTAAGG - Intergenic
1197923500 X:131621558-131621580 CTGTGCCAAGGGCTGTTATAAGG - Intergenic