ID: 1172525097

View in Genome Browser
Species Human (GRCh38)
Location 20:35595955-35595977
Sequence CTGGAGCTCAAGAGCAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172525097_1172525104 25 Left 1172525097 20:35595955-35595977 CCAGCCTTGCTCTTGAGCTCCAG No data
Right 1172525104 20:35596003-35596025 TACCCTGGCTACCCCAGGTGTGG No data
1172525097_1172525100 10 Left 1172525097 20:35595955-35595977 CCAGCCTTGCTCTTGAGCTCCAG No data
Right 1172525100 20:35595988-35596010 TACTTAACCACCTACTACCCTGG No data
1172525097_1172525103 20 Left 1172525097 20:35595955-35595977 CCAGCCTTGCTCTTGAGCTCCAG No data
Right 1172525103 20:35595998-35596020 CCTACTACCCTGGCTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172525097 Original CRISPR CTGGAGCTCAAGAGCAAGGC TGG (reversed) Intergenic