ID: 1172525098

View in Genome Browser
Species Human (GRCh38)
Location 20:35595959-35595981
Sequence AGCTCTGGAGCTCAAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172525098_1172525100 6 Left 1172525098 20:35595959-35595981 CCTTGCTCTTGAGCTCCAGAGCT No data
Right 1172525100 20:35595988-35596010 TACTTAACCACCTACTACCCTGG No data
1172525098_1172525107 28 Left 1172525098 20:35595959-35595981 CCTTGCTCTTGAGCTCCAGAGCT No data
Right 1172525107 20:35596010-35596032 GCTACCCCAGGTGTGGCCCATGG No data
1172525098_1172525104 21 Left 1172525098 20:35595959-35595981 CCTTGCTCTTGAGCTCCAGAGCT No data
Right 1172525104 20:35596003-35596025 TACCCTGGCTACCCCAGGTGTGG No data
1172525098_1172525103 16 Left 1172525098 20:35595959-35595981 CCTTGCTCTTGAGCTCCAGAGCT No data
Right 1172525103 20:35595998-35596020 CCTACTACCCTGGCTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172525098 Original CRISPR AGCTCTGGAGCTCAAGAGCA AGG (reversed) Intergenic