ID: 1172525099

View in Genome Browser
Species Human (GRCh38)
Location 20:35595974-35595996
Sequence GGTTAAGTATTAGCGAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172525099_1172525100 -9 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525100 20:35595988-35596010 TACTTAACCACCTACTACCCTGG No data
1172525099_1172525107 13 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525107 20:35596010-35596032 GCTACCCCAGGTGTGGCCCATGG No data
1172525099_1172525103 1 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525103 20:35595998-35596020 CCTACTACCCTGGCTACCCCAGG No data
1172525099_1172525111 27 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525111 20:35596024-35596046 GGCCCATGGACCAACAGCACTGG No data
1172525099_1172525104 6 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525104 20:35596003-35596025 TACCCTGGCTACCCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172525099 Original CRISPR GGTTAAGTATTAGCGAGCTC TGG (reversed) Intergenic