ID: 1172525100

View in Genome Browser
Species Human (GRCh38)
Location 20:35595988-35596010
Sequence TACTTAACCACCTACTACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172525096_1172525100 26 Left 1172525096 20:35595939-35595961 CCAAAAATCATTAAGGCCAGCCT No data
Right 1172525100 20:35595988-35596010 TACTTAACCACCTACTACCCTGG No data
1172525099_1172525100 -9 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525100 20:35595988-35596010 TACTTAACCACCTACTACCCTGG No data
1172525097_1172525100 10 Left 1172525097 20:35595955-35595977 CCAGCCTTGCTCTTGAGCTCCAG No data
Right 1172525100 20:35595988-35596010 TACTTAACCACCTACTACCCTGG No data
1172525098_1172525100 6 Left 1172525098 20:35595959-35595981 CCTTGCTCTTGAGCTCCAGAGCT No data
Right 1172525100 20:35595988-35596010 TACTTAACCACCTACTACCCTGG No data
1172525095_1172525100 27 Left 1172525095 20:35595938-35595960 CCCAAAAATCATTAAGGCCAGCC No data
Right 1172525100 20:35595988-35596010 TACTTAACCACCTACTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172525100 Original CRISPR TACTTAACCACCTACTACCC TGG Intergenic
No off target data available for this crispr