ID: 1172525103 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 20:35595998-35596020 |
Sequence | CCTACTACCCTGGCTACCCC AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1172525099_1172525103 | 1 | Left | 1172525099 | 20:35595974-35595996 | CCAGAGCTCGCTAATACTTAACC | No data | ||
Right | 1172525103 | 20:35595998-35596020 | CCTACTACCCTGGCTACCCCAGG | No data | ||||
1172525098_1172525103 | 16 | Left | 1172525098 | 20:35595959-35595981 | CCTTGCTCTTGAGCTCCAGAGCT | No data | ||
Right | 1172525103 | 20:35595998-35596020 | CCTACTACCCTGGCTACCCCAGG | No data | ||||
1172525097_1172525103 | 20 | Left | 1172525097 | 20:35595955-35595977 | CCAGCCTTGCTCTTGAGCTCCAG | No data | ||
Right | 1172525103 | 20:35595998-35596020 | CCTACTACCCTGGCTACCCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1172525103 | Original CRISPR | CCTACTACCCTGGCTACCCC AGG | Intergenic | ||