ID: 1172525104

View in Genome Browser
Species Human (GRCh38)
Location 20:35596003-35596025
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1172525098_1172525104 21 Left 1172525098 20:35595959-35595981 CCTTGCTCTTGAGCTCCAGAGCT No data
Right 1172525104 20:35596003-35596025 TACCCTGGCTACCCCAGGTGTGG No data
1172525097_1172525104 25 Left 1172525097 20:35595955-35595977 CCAGCCTTGCTCTTGAGCTCCAG No data
Right 1172525104 20:35596003-35596025 TACCCTGGCTACCCCAGGTGTGG No data
1172525099_1172525104 6 Left 1172525099 20:35595974-35595996 CCAGAGCTCGCTAATACTTAACC No data
Right 1172525104 20:35596003-35596025 TACCCTGGCTACCCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1172525104 Original CRISPR TACCCTGGCTACCCCAGGTG TGG Intergenic